Skip to main content
. 2004 Jun;78(12):6200–6208. doi: 10.1128/JVI.78.12.6200-6208.2004

FIG. 5.

FIG. 5.

Mapping of the recombination site between Ad5.1FGF-4 and pIG.E1A.E1B. (A) Schematic drawing of the 5′ end of the Ad5.1FGF-4 genome, with location and orientation of oligonucleotides used in a PCR to amplify the genome region between the FGF-4 cDNA and pIG.E1A.E1B. (B) Ethidium bromide-stained gel of PCR products. Numbers 1 to 6 above the lanes correspond with oligonucleotides used in combination with the forward FGF-4 primer. M, molecular weight markers, from bacteriophage λ DNA digested with HindIII. Primers used were AGCAAGGGCAAGCTCTATG (FGF-4), TCTTGGACTCCCAGCAATG (oligonucleotide 1), ATGATTACGCCAAGCTAATTC (2), CTCACCAGTCACAGAAAAGCA (3),TTTATCCGCCTCCATCCAGTC (4), CTGCCCATCCTCTGTAATTG (5), and CGCTAATGAGCTTGATCTGC (6).