Skip to main content
. Author manuscript; available in PMC: 2015 Sep 1.
Published in final edited form as: Exp Hematol. 2014 May 20;42(9):761–772.e10. doi: 10.1016/j.exphem.2014.05.005

Table 1. List of primers used in this study.

Reporter construction primers (AttB sequences in red, genomic hybridizing sequences in blue)
CD45 prom −164 AttB1-F ggggacaagtttgtacaaaaaagcaggcttacctttagaggaaaattgagacga
CD45 prom +168 AttB2-R ggggaccactttgtacaagaaagctgggtaaataatggttatctctcttgaagtttg
Quantitative real-time PCR primers
CD34 qRT-PCR-F ggtagctctctgcctgatgagt
CD34 qRT-PCR-R ttggtaggaactgatggggata
CD45 qRT-PCR-F ggcagatgatattccaaagaaa
CD45 qRT-PCR-R atctccacttccatgtctccat
Myb qRT-PCR-F gagatgtgtgaccatgactacga
Myb qRT-PCR-R gttctgttccaccagcttcttc
Vav1 qRT-PCR-F gcagtgaactctttgaggcttt
Vav1 qRT-PCR-R gattcctttgttctgggcaat
Hprt1 qRT-PCR-F aactttgctttccctggttaa
Hprt1 qRT-PCR-R tcaagggcatatccaacaaca
Gapdh qRT-PCR-F tgtgtccgtcgtggatctga
Gapdh qRT-PCR-R cctgcttcaccaccttcttga
Lentiviral vector titering primers
LV WPRE-F accacctgtcagctcctttc
LV WPRE-R caacaccacggaattgtcagt
LV VSV-G-F ccattattgcccgtcaagctc
LV VSV-G-R ggagtgaaggatcggatggact
LV gag-F atgggtgcgagagcgtcagt
LV gag-R caggccaggattaactgcga