Table 1.
PCR primers and thermal cycling conditions
| Primer pair | Primer sequence | Primer location | Thermal cycling |
|---|---|---|---|
| 1 | 5′TGTCACGGATACTTCCTCTTTGGTC 5′GAGGGCCAACTTTGCTAGAAGAGAC |
Opn1sw exon 1 Opn1sw exon 5 |
94°C for 3 min; 35 cycles of 94°C for 30 sec, 68°C for 1.5 min; 72°C for 10 min |
| 2 | 5′ttcttccagttctggaatgaatgtttg 5′AGTCCTCAGCAACTGGGAGTAGGAGAAG |
Opn1sw intron 2 Opn1sw exon 3 |
95°C for 9 min; 38 cycles of 94°C for 30 sec, 61.5°C for 40 sec; 72°C for 10 min |
| 3 | 5′tctcttcttccgtgtagGAATCACAGG 5′acacccttacCTGCTCCAACCAAAG |
Opn1mw intron 2/exon 3 Opn1mw intron 3/exon 2 |
95°C for 9 min; 8 cycles of 94°C for 45 sec, 65°C for 45 sec; 32 cycles of 94°C for 1 min, 65°C for 45 sec; 72°C for 10 min |
| 4 | 5′GGATCACAGGTCTCTGGTCTC 5′CTGCTCCAACCAAAGATGG |
Opn1lwLlAIS exon 3 Opn1lwLlAIS exon 3 |
95°C for 9 min; 8 cycles of 94°C for 45 sec, 59°C for 45 sec; 32 cycles of 94°C for 1 min, 59°C for 45 sec; 72°C for 10 min |
| 5 | 5′cttctttgccacacttggagGTGAAATC 5′GCCATGATCCAGGTGAAGACCACAC |
Rho intron 1/exon 2 Rho exon 2 |
94°C for 3 min; 35 cycles of 94°C for 30 sec, 68°C for 1.5 min; 72°C for 10 min |