Skip to main content
. Author manuscript; available in PMC: 2015 Jan 1.
Published in final edited form as: Vis Neurosci. 2014 Jan;31(1):25–37. doi: 10.1017/S0952523813000515

Table 1.

PCR primers and thermal cycling conditions

Primer pair Primer sequence Primer location Thermal cycling
1 5′TGTCACGGATACTTCCTCTTTGGTC
5′GAGGGCCAACTTTGCTAGAAGAGAC
Opn1sw exon 1
Opn1sw exon 5
94°C for 3 min; 35 cycles of 94°C for 30 sec, 68°C for 1.5 min; 72°C for 10 min
2 5′ttcttccagttctggaatgaatgtttg
5′AGTCCTCAGCAACTGGGAGTAGGAGAAG
Opn1sw intron 2
Opn1sw exon 3
95°C for 9 min; 38 cycles of 94°C for 30 sec, 61.5°C for 40 sec; 72°C for 10 min
3 5′tctcttcttccgtgtagGAATCACAGG
5′acacccttacCTGCTCCAACCAAAG
Opn1mw intron 2/exon 3
Opn1mw intron 3/exon 2
95°C for 9 min; 8 cycles of 94°C for 45 sec, 65°C for 45 sec; 32 cycles of 94°C for 1 min, 65°C for 45 sec; 72°C for 10 min
4 5′GGATCACAGGTCTCTGGTCTC
5′CTGCTCCAACCAAAGATGG
Opn1lwLlAIS exon 3
Opn1lwLlAIS exon 3
95°C for 9 min; 8 cycles of 94°C for 45 sec, 59°C for 45 sec; 32 cycles of 94°C for 1 min, 59°C for 45 sec; 72°C for 10 min
5 5′cttctttgccacacttggagGTGAAATC
5′GCCATGATCCAGGTGAAGACCACAC
Rho intron 1/exon 2
Rho exon 2
94°C for 3 min; 35 cycles of 94°C for 30 sec, 68°C for 1.5 min; 72°C for 10 min