TABLE 4.
Ld25A gene | Start position | End position | Length (aa) | Size (kDa) | Strand | RBS/start codona | ORF(s) and % similarityb |
Predicted function | Representative similarity to proteins in database | % identity (no. of aa) | E-value | |||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Ld3 |
Ld17 |
|||||||||||||
ORF | %S | ORF | %S | |||||||||||
1 | 90 | 515 | 142 | 15.62 | + | AAAAGCGAGGTTAAAAATG | 1 | 95 | Putative ParB nuclease | Putative ParB nuclease (Lactobacillus phage c5) | 97 (88) | 5.00E–55 | ||
2 | 647 | 1012 | 122 | 13.42 | + | AAGGAGTGAAAGAACATG | 2 | 97 | 2 | 97 | Putative terminase small subunit | Hypothetical protein (Lactobacillus phage c5) | 95 (115) | 4.00E–78 |
3 | 1002 | 2681 | 560 | 61.6 | + | ATAAATGGCGGCGAAGACAATG | 3 | 96 | 3 | 96 | Putative terminase large subunit | Putative terminase large subunit (Lactobacillus phage c5) | 98 (549) | 0 |
4 | 2698 | 3912 | 405 | 44.55 | + | TTAAGTTTGGGGGTGATTGATTG | 4 | 97 | 5 | 97 | Putative portal protein | Putative portal protein (Lactobacillus phage LL-Ku) | 97 (393) | 0 |
5 | 3902 | 4507 | 202 | 22.22 | + | AGGAGGTGAAGAAACAGATG | 5 | 98 | 6 | 98 | Putative ClpP protease | Putative ClpP protease (Lactobacillus phage c5) | 98 (196) | 4.00E–140 |
6 | 4510 | 5697 | 396 | 43.56 | + | TTAAGGAGGACGACTAAATATG | 6 | 96 | 7 | 95 | Putative major head protein | Putative major head protein (Lactobacillus phage c5) | 95 (376) | 0.00E + 00 |
7 | 5706 | 5873 | 56 | 6.16 | + | AGCCGGTTAATCAAAAAGATG | 7 | 96 | 8 | 96 | Hypothetical protein (Lactobacillus phage c5) | 96 (53) | 2.00E–30 | |
8 | 5866 | 6162 | 99 | 10.89 | + | AAAGGAGGTTGCTAAGAATG | 8 | 90 | 9 | 89 | Hypothetical protein (Lactobacillus phage LL-Ku) | 89 (87) | 9.00E–56 | |
9 | 6173 | 6526 | 118 | 12.98 | + | CTGTAAGGAGGTCATCATG | 9 | 99 | 10 | 99 | Putative head-tail adaptor | Putative head-tail adaptor (Lactobacillus phage c5) | 98 (115) | 7.00E–78 |
10 | 6526 | 6957 | 144 | 15.84 | + | GAAAGCGGTGATAAAGTAATG | 10 | 99 | 11 | 98 | Hypothetical protein (Lactobacillus phage c5) | 98 (141) | 2.00E–96 | |
11 | 6950 | 7291 | 114 | 12.54 | + | AGTGGAGGTCTATTAGGAGATG | 11 | 100 | 12 | 99 | Hypothetical protein (Lactobacillus phage c5) | 99 (112) | 3.00E–76 | |
12 | 7306 | 7878 | 191 | 21.01 | + | TAACGGAGGTTTTAAATATG | 12 | 100 | 13 | 98 | Putative major tail protein | Putative major tail protein (Lactobacillus phage c5) | 97 (183) | 5.00E–130 |
13 | 7898 | 8248 | 117 | 12.87 | + | TTGATGAGGTGAAGCACGATG | 13 | 100 | 14 | 99 | Hypothetical protein (Lactobacillus phage LL-Ku) | 100 (116) | 1.00E–76 | |
14 | 8493 | 11399 | 969 | 106.59 | + | AAATGGAGGTGATTTCATG | 14 | 97 | 15 | 96 | Putative tape measure protein | Putative tape measure protein (Lactobacillus phage c5) | 99 (955) | 0.00E + 00 |
15 | 11411 | 12115 | 235 | 25.85 | + | GATAGGAGGGCAGATAATG | 15 | 100 | 16 | 98 | Putative tail component | Putative tail component (Lactobacillus phage c5) | 99 (231) | 6.00E–166 |
16 | 12112 | 12450 | 113 | 12.43 | + | TATACGAGGTGGATATG | 16 | 99 | 17 | 96 | Hypothetical protein (Lactobacillus phage LL-Ku) | 95 (106) | 1.00E–71 | |
17 | 12464 | 15100 | 879 | 96.69 | + | TAAAAAGGTGGTTACTATG | 17 | 91 | 18 | 93 | Glycerophosphoryl diesterphosphodiesterase | Glycerophosphoryl diesterphosphodiesterase (Lactobacillus phage LL-Ku) | 93 (818) | 0.00E + 00 |
18 | 15248 | 16243 | 332 | 36.52 | + | GTGTGAGGAGGTAATATTTATG | 19 | 91 | Collagen repeat-containing protein | 34.8-kDa protein (Lactobacillus phage LL-K) | 81 (271) | 0 | ||
19 | 16248 | 16802 | 185 | 20.35 | + | CATTGAGGGGTGATTGAATG | 20 | 31 | Putative adsorption protein | Putative adsorption protein (Lactobacillus equicursoris CIP 110162) | 63 (99) | 8.00E–54 | ||
20 | 16804 | 18687 | 628 | 69.08 | + | AGACGTAGGAGCTTAACATG | 18 | 82 | 21 | 89 | Putative antireceptor | Putative antireceptor (Lactobacillus phage LL-Ku) | 87 (564) | 0.00E + 00 |
21 | 18700 | 19059 | 120 | 13.2 | + | TTAATGGAGTAAGCGAATG | 19 | 90 | 22 | 83 | Hypothetical protein (Lactobacillus phage c5) | 86 (102) | 9.00E–68 | |
22 | 19449 | 19652 | 68 | 7.48 | + | AAGGATGTACAAAGAAAATG | 20 | 91 | 23 | 91 | Putative Cro-like repressor | Putative Cro-like repressor (Lactobacillus phage c5) | 88 (59) | 7.00E–37 |
23 | 19655 | 19825 | 57 | 6.27 | + | AAGGAGGAAATGTAAAAATG | 21 | 88 | Hypothetical protein (Lactobacillus phage c5) | 96 (54) | 6.00E–27 | |||
24 | 19818 | 20444 | 209 | 22.99 | + | GATGGAGGAAGAAAAAAATG | 23, 22 | 87, 92 | 24 | 91 | Hypothetical protein (Lactobacillus phage c5) | 96 (199) | 6.00E–141 | |
25 | 20447 | 20725 | 93 | 10.23 | + | GGGAAGGACTTCTAAAAATG | 24 | 92 | 25 | 92 | Hypothetical protein (Lactobacillus phage LL-Ku) | 92 (82) | 1.00E–52 | |
26 | 20718 | 21035 | 106 | 11.66 | + | TAAGTGGAGCAATGACGATG | 25 | 96 | 26 | 96 | Hypothetical protein (Lactobacillus phage LL-Ku) | 96 (101) | 8.00E–66 | |
27 | 21040 | 21645 | 202 | 22.22 | + | GTAAAGGATTAAGCGAATG | 26 | 93 | 27 | 93 | Hypothetical protein (Lactobacillus phage LL-Ku) | 92 (185) | 1.00E–135 | |
28 | 21635 | 22096 | 154 | 16.94 | + | AGATTGGAGAAATAAACATG | 27 | 83 | 28 | 83 | Putative single-stranded DNA binding protein | Putative single-stranded DNA-binding protein (Lactobacillus phage LL-Ku) | 87 (133) | 2.00E–93 |
29 | 22107 | 22646 | 180 | 19.8 | + | CGTTTTAGGTGATGCAAGATG | 28 | 92 | 29 | 92 | Hypothetical protein (Lactobacillus phage c5) | 90 (161) | 4.00E–93 | |
30 | 22627 | 22908 | 94 | 10.34 | + | ATAGAGGCATTGAAAAGTG | 29 | 94 | 30 | 94 | Hypothetical protein (Lactobacillus phage LL-Ku) | 91 (85) | 6.00E–93 | |
31 | 22905 | 23276 | 124 | 13.64 | + | TCGGGAGGAACTGGTTATG | 31 | 100 | 32 | 91 | Putative Holliday junction resolvase | Putative Holliday junction resolvase (Lactobacillus phage LL-Ku) | 91 (107) | 8.00E–93 |
32 | 23588 | 23740 | 51 | 5.61 | + | GATAGGAGGTACACAAAATG | 32 | 88 | 34 | 88 | Hypothetical protein (Lactobacillus phage LL-Ku) | 88 (44) | 1.00E–92 | |
33 | 23795 | 24136 | 114 | 12.54 | + | TAAAGGAGTTTAAAAATG | 33 | 64 | Hypothetical protein HMPREF9465_00185 (Sutterella wadsworthensis 2_1_59BFAA) | 51 (50) | 1.00E–25 | |||
34 | 24164 | 24973 | 270 | 29.7 | + | CAGGAGGATCTTAAAAATG | 35 | 75 | 35 | 59 | Putative DNA replication protein | Putative DNA replication protein (Lactobacillus phage LL-Ku) | 66 (179) | 3.00E–90 |
35 | 24942 | 25757 | 272 | 29.92 | + | ATACGGAGGTAAAACGAGATG | 36 | 94 | 36 | 94 | Putative DnaC | Putative DnaC (Lactobacillus phage LL-Ku) | 95 (258) | 0 |
36 | 25915 | 26706 | 264 | 29.04 | + | AAAGGAGAAAACAAAATG | 37, 38 | 47, 92 | 37, 38 | 86, 77 | Phage antirepressor protein | Phage antirepressor protein (Lactobacillus casei A2–362) | 61 (157) | 2.00E–111 |
37 | 26871 | 27629 | 253 | 27.83 | + | AAAGGAAAAAACAAAATG | 37, 38 | 99, 98 | 38 | 97 | Phage antirepressor protein | Phage antirepressor (Staphylococcus prophage phiPV83) | 60 (150) | 1.00E–105 |
38 | 27771 | 27959 | 63 | 6.93 | + | AAAACGAGGTATTAAAAATG | 39 | 98 | 39 | 98 | Hypothetical protein (Lactobacillus phage LL-Ku) | 94 (58) | 3.00E–31 | |
39 | 27999 | 28400 | 134 | 14.74 | + | AAATAGAGGTAAACAAAATG | Hypothetical protein (Lactobacillus phage LL-Ku) | 88 (117) | 3.00E–75 | |||||
40 | 28427 | 28591 | 55 | 6.05 | + | AAAGGAGGAACTAAACATG | 46 | 63 | 47 | 63 | Hypothetical protein (Lactobacillus phage JCL1032) | 40 (17) | 8.40E + 00 | |
41 | 28606 | 28770 | 55 | 6.05 | + | AACTGGAGGTACAAAAATG | 39, 46 | 50, 37 | 39, 47 | 51, 37 | Hypothetical protein (Lactobacillus phage LL-Ku) | 51 (25) | 7.00E–06 | |
42 | 28785 | 29009 | 75 | 8.25 | + | TAAGCGGAGAAACAATCATG | Hypothetical protein (Lactobacillus phage LL-Ku) | 66 (41) | 5.00E–17 | |||||
43 | 28996 | 29208 | 71 | 7.81 | + | AGTGCGAGGCGGAAAATG | 41 | 74 | Hypothetical protein (Lactobacillus phage c5) | 93 (65) | 2.00E–38 | |||
44 | 29399 | 29665 | 89 | 9.79 | + | GATTGAGGCATTAAGCAAATG | 41 | 85 | 42 | 85 | hypothetical protein (Lactobacillus phage LL-Ku) | 97 (85) | 2.00E–54 | |
45 | 29662 | 29901 | 80 | 8.8 | + | TGAGGCAGGAGATCCGAAAAAATG | 42 | 85 | 43 | 85 | Hypothetical protein (Lactobacillus phage LL-Ku) | 76 (59) | 2.00E–37 | |
46 | 29898 | 30137 | 80 | 8.8 | + | AATGGAGGAAACGAGACCATG | 43 | 82 | 44 | 82 | Hypothetical protein (Lactobacillus phage LL-Ku) | 83 (65) | 7.00E–42 | |
47 | 30134 | 30622 | 163 | 17.93 | + | GAACGGGGGCTACCAAAATG | 44 | 64 | 45 | 67 | Hypothetical protein (Lactobacillus phage c5) | 64 (103) | 2.00E–60 | |
48 | 30628 | 30801 | 58 | 6.38 | + | CGGAAGGACTAAAAATCATG | 45 | 84 | 46 | 86 | Hypothetical protein (Lactobacillus phage LL-Ku) | 86 (49) | 2.00E–28 | |
49 | 31133 | 31426 | 98 | 10.78 | + | AAGGAGGAACTTAAAATATG | 47 | 89 | 48 | 89 | Putative holin | Putative holin (Lactobacillus phage c5) | 90 (87) | 5.00E–53 |
50 | 31419 | 32324 | 302 | 33.22 | + | TAAGGGAGACGAAAATATTG | 48 | 87 | 49 | 86 | Putative lysin | Putative lysin (Lactobacillus phage LL-Ku) | 85 (256) | 0.00E + 00 |
51 | 32328 | 32708 | 127 | 13.97 | + | Translationally fused | 49 | 94 | 50 | 95 | Hypothetical protein (Lactobacillus phage LL-Ku) | 97 (122) | 1.00E–82 |
RBS, ribosome binding site. Sequences in boldface represent the putative RBS, followed by the putative start codon for each ORF.
That is, the percent identity at the indicated amino acid level to ORFs in the NCBI database (total number of amino acid matches). %S, % similarity.