Skip to main content
. 2014 Sep;80(18):5623–5635. doi: 10.1128/AEM.01268-14

TABLE 4.

ORFs deduced from Ld25A, Ld3, and Ld17 and their predicted proteins

Ld25A gene Start position End position Length (aa) Size (kDa) Strand RBS/start codona ORF(s) and % similarityb
 Predicted function Representative similarity to proteins in database % identity (no. of aa) E-value
Ld3
 Ld17
ORF %S ORF %S
1 90 515 142 15.62 + AAAAGCGAGGTTAAAAATG 1 95 Putative ParB nuclease Putative ParB nuclease (Lactobacillus phage c5) 97 (88) 5.00E–55
2 647 1012 122 13.42 + AAGGAGTGAAAGAACATG 2 97 2 97 Putative terminase small subunit Hypothetical protein (Lactobacillus phage c5) 95 (115) 4.00E–78
3 1002 2681 560 61.6 + ATAAATGGCGGCGAAGACAATG 3 96 3 96 Putative terminase large subunit Putative terminase large subunit (Lactobacillus phage c5) 98 (549) 0
4 2698 3912 405 44.55 + TTAAGTTTGGGGGTGATTGATTG 4 97 5 97 Putative portal protein Putative portal protein (Lactobacillus phage LL-Ku) 97 (393) 0
5 3902 4507 202 22.22 + AGGAGGTGAAGAAACAGATG 5 98 6 98 Putative ClpP protease Putative ClpP protease (Lactobacillus phage c5) 98 (196) 4.00E–140
6 4510 5697 396 43.56 + TTAAGGAGGACGACTAAATATG 6 96 7 95 Putative major head protein Putative major head protein (Lactobacillus phage c5) 95 (376) 0.00E + 00
7 5706 5873 56 6.16 + AGCCGGTTAATCAAAAAGATG 7 96 8 96 Hypothetical protein (Lactobacillus phage c5) 96 (53) 2.00E–30
8 5866 6162 99 10.89 + AAAGGAGGTTGCTAAGAATG 8 90 9 89 Hypothetical protein (Lactobacillus phage LL-Ku) 89 (87) 9.00E–56
9 6173 6526 118 12.98 + CTGTAAGGAGGTCATCATG 9 99 10 99 Putative head-tail adaptor Putative head-tail adaptor (Lactobacillus phage c5) 98 (115) 7.00E–78
10 6526 6957 144 15.84 + GAAAGCGGTGATAAAGTAATG 10 99 11 98 Hypothetical protein (Lactobacillus phage c5) 98 (141) 2.00E–96
11 6950 7291 114 12.54 + AGTGGAGGTCTATTAGGAGATG 11 100 12 99 Hypothetical protein (Lactobacillus phage c5) 99 (112) 3.00E–76
12 7306 7878 191 21.01 + TAACGGAGGTTTTAAATATG 12 100 13 98 Putative major tail protein Putative major tail protein (Lactobacillus phage c5) 97 (183) 5.00E–130
13 7898 8248 117 12.87 + TTGATGAGGTGAAGCACGATG 13 100 14 99 Hypothetical protein (Lactobacillus phage LL-Ku) 100 (116) 1.00E–76
14 8493 11399 969 106.59 + AAATGGAGGTGATTTCATG 14 97 15 96 Putative tape measure protein Putative tape measure protein (Lactobacillus phage c5) 99 (955) 0.00E + 00
15 11411 12115 235 25.85 + GATAGGAGGGCAGATAATG 15 100 16 98 Putative tail component Putative tail component (Lactobacillus phage c5) 99 (231) 6.00E–166
16 12112 12450 113 12.43 + TATACGAGGTGGATATG 16 99 17 96 Hypothetical protein (Lactobacillus phage LL-Ku) 95 (106) 1.00E–71
17 12464 15100 879 96.69 + TAAAAAGGTGGTTACTATG 17 91 18 93 Glycerophosphoryl diesterphosphodiesterase Glycerophosphoryl diesterphosphodiesterase (Lactobacillus phage LL-Ku) 93 (818) 0.00E + 00
18 15248 16243 332 36.52 + GTGTGAGGAGGTAATATTTATG 19 91 Collagen repeat-containing protein 34.8-kDa protein (Lactobacillus phage LL-K) 81 (271) 0
19 16248 16802 185 20.35 + CATTGAGGGGTGATTGAATG 20 31 Putative adsorption protein Putative adsorption protein (Lactobacillus equicursoris CIP 110162) 63 (99) 8.00E–54
20 16804 18687 628 69.08 + AGACGTAGGAGCTTAACATG 18 82 21 89 Putative antireceptor Putative antireceptor (Lactobacillus phage LL-Ku) 87 (564) 0.00E + 00
21 18700 19059 120 13.2 + TTAATGGAGTAAGCGAATG 19 90 22 83 Hypothetical protein (Lactobacillus phage c5) 86 (102) 9.00E–68
22 19449 19652 68 7.48 + AAGGATGTACAAAGAAAATG 20 91 23 91 Putative Cro-like repressor Putative Cro-like repressor (Lactobacillus phage c5) 88 (59) 7.00E–37
23 19655 19825 57 6.27 + AAGGAGGAAATGTAAAAATG 21 88 Hypothetical protein (Lactobacillus phage c5) 96 (54) 6.00E–27
24 19818 20444 209 22.99 + GATGGAGGAAGAAAAAAATG 23, 22 87, 92 24 91 Hypothetical protein (Lactobacillus phage c5) 96 (199) 6.00E–141
25 20447 20725 93 10.23 + GGGAAGGACTTCTAAAAATG 24 92 25 92 Hypothetical protein (Lactobacillus phage LL-Ku) 92 (82) 1.00E–52
26 20718 21035 106 11.66 + TAAGTGGAGCAATGACGATG 25 96 26 96 Hypothetical protein (Lactobacillus phage LL-Ku) 96 (101) 8.00E–66
27 21040 21645 202 22.22 + GTAAAGGATTAAGCGAATG 26 93 27 93 Hypothetical protein (Lactobacillus phage LL-Ku) 92 (185) 1.00E–135
28 21635 22096 154 16.94 + AGATTGGAGAAATAAACATG 27 83 28 83 Putative single-stranded DNA binding protein Putative single-stranded DNA-binding protein (Lactobacillus phage LL-Ku) 87 (133) 2.00E–93
29 22107 22646 180 19.8 + CGTTTTAGGTGATGCAAGATG 28 92 29 92 Hypothetical protein (Lactobacillus phage c5) 90 (161) 4.00E–93
30 22627 22908 94 10.34 + ATAGAGGCATTGAAAAGTG 29 94 30 94 Hypothetical protein (Lactobacillus phage LL-Ku) 91 (85) 6.00E–93
31 22905 23276 124 13.64 + TCGGGAGGAACTGGTTATG 31 100 32 91 Putative Holliday junction resolvase Putative Holliday junction resolvase (Lactobacillus phage LL-Ku) 91 (107) 8.00E–93
32 23588 23740 51 5.61 + GATAGGAGGTACACAAAATG 32 88 34 88 Hypothetical protein (Lactobacillus phage LL-Ku) 88 (44) 1.00E–92
33 23795 24136 114 12.54 + TAAAGGAGTTTAAAAATG 33 64 Hypothetical protein HMPREF9465_00185 (Sutterella wadsworthensis 2_1_59BFAA) 51 (50) 1.00E–25
34 24164 24973 270 29.7 + CAGGAGGATCTTAAAAATG 35 75 35 59 Putative DNA replication protein Putative DNA replication protein (Lactobacillus phage LL-Ku) 66 (179) 3.00E–90
35 24942 25757 272 29.92 + ATACGGAGGTAAAACGAGATG 36 94 36 94 Putative DnaC Putative DnaC (Lactobacillus phage LL-Ku) 95 (258) 0
36 25915 26706 264 29.04 + AAAGGAGAAAACAAAATG 37, 38 47, 92 37, 38 86, 77 Phage antirepressor protein Phage antirepressor protein (Lactobacillus casei A2–362) 61 (157) 2.00E–111
37 26871 27629 253 27.83 + AAAGGAAAAAACAAAATG 37, 38 99, 98 38 97 Phage antirepressor protein Phage antirepressor (Staphylococcus prophage phiPV83) 60 (150) 1.00E–105
38 27771 27959 63 6.93 + AAAACGAGGTATTAAAAATG 39 98 39 98 Hypothetical protein (Lactobacillus phage LL-Ku) 94 (58) 3.00E–31
39 27999 28400 134 14.74 + AAATAGAGGTAAACAAAATG Hypothetical protein (Lactobacillus phage LL-Ku) 88 (117) 3.00E–75
40 28427 28591 55 6.05 + AAAGGAGGAACTAAACATG 46 63 47 63 Hypothetical protein (Lactobacillus phage JCL1032) 40 (17) 8.40E + 00
41 28606 28770 55 6.05 + AACTGGAGGTACAAAAATG 39, 46 50, 37 39, 47 51, 37 Hypothetical protein (Lactobacillus phage LL-Ku) 51 (25) 7.00E–06
42 28785 29009 75 8.25 + TAAGCGGAGAAACAATCATG Hypothetical protein (Lactobacillus phage LL-Ku) 66 (41) 5.00E–17
43 28996 29208 71 7.81 + AGTGCGAGGCGGAAAATG 41 74 Hypothetical protein (Lactobacillus phage c5) 93 (65) 2.00E–38
44 29399 29665 89 9.79 + GATTGAGGCATTAAGCAAATG 41 85 42 85 hypothetical protein (Lactobacillus phage LL-Ku) 97 (85) 2.00E–54
45 29662 29901 80 8.8 + TGAGGCAGGAGATCCGAAAAAATG 42 85 43 85 Hypothetical protein (Lactobacillus phage LL-Ku) 76 (59) 2.00E–37
46 29898 30137 80 8.8 + AATGGAGGAAACGAGACCATG 43 82 44 82 Hypothetical protein (Lactobacillus phage LL-Ku) 83 (65) 7.00E–42
47 30134 30622 163 17.93 + GAACGGGGGCTACCAAAATG 44 64 45 67 Hypothetical protein (Lactobacillus phage c5) 64 (103) 2.00E–60
48 30628 30801 58 6.38 + CGGAAGGACTAAAAATCATG 45 84 46 86 Hypothetical protein (Lactobacillus phage LL-Ku) 86 (49) 2.00E–28
49 31133 31426 98 10.78 + AAGGAGGAACTTAAAATATG 47 89 48 89 Putative holin Putative holin (Lactobacillus phage c5) 90 (87) 5.00E–53
50 31419 32324 302 33.22 + TAAGGGAGACGAAAATATTG 48 87 49 86 Putative lysin Putative lysin (Lactobacillus phage LL-Ku) 85 (256) 0.00E + 00
51 32328 32708 127 13.97 + Translationally fused 49 94 50 95 Hypothetical protein (Lactobacillus phage LL-Ku) 97 (122) 1.00E–82
a

RBS, ribosome binding site. Sequences in boldface represent the putative RBS, followed by the putative start codon for each ORF.

b

That is, the percent identity at the indicated amino acid level to ORFs in the NCBI database (total number of amino acid matches). %S, % similarity.