TABLE 3.
Genes in the RNA-Seq data with high-scoring esa boxes
| ASAP no. | Locus tag (gene name) | Protein productd | Fold regulationa | Predicted EsaR binding sequence | esa box scoreb | Promoter bound by EsaR (reference) |
|---|---|---|---|---|---|---|
| ACV-0290094c | CKS-2903 (esaR) | Quorum-sensing transcriptional activator EsaR | 5.4 (A) | GCCTGTACTATAGTGCAGGT | 14.9 | Yes (8) |
| ACV-0290502c | CKS-0482 (dkgA) | 2,5-Diketo-d-gluconate reductase A | 6.7 (R) | AGCTAGACTTAAGCACAGCG | 11.6 | Yes (13) |
| ACV-0288416 | CKS-0970 (uspB) | Universal stress protein B | 2.4 (R) | ACCGGCACCGCAGAACAGTG | 10.6 | Weakly |
| ACV-0285895c | CKS-2075 (lrhA) | LysR family transcriptional regulator LrhA | 3.1 (A) | AGAGCATCTTTAGTACAGGT | 8.9 | Yes (13) |
| ACV-0289544 | CKS-2241 (wceG1) | Undecaprenol-phosphate galactose-phosphotransferase/O-antigen transferase | 3.3 (R) | GGCTCAACATCAGTACTGTT | 8.8 | No |
| ACV-0290308 | CKS-0678 | C-terminal fragment of a PLP-dependent catabolic threonine dehydratase | 2.6 (A) | CCCTGCCCGGCAATACTGGG | 8.5 | Yes |
| ACV-0291078 | CKS-1289 | Endoribonuclease l-PSP | 2.1 (A) | ACCTATCCGGTATTGCAGAT | 8.4 | No |
| ACV-0286411 | CKS-3275 (hrpN) | Elicitor of the hypersensitivity reaction HrpN | 2.1 (A) | AGCGGCACTTAATAAAAGCT | 8.1 | No |
| ACV-0288415 | CKS-0971 (uspA) | Universal stress global response regulator | 2.3 (R) | GCATTGCCTGTATTGCAGGT | 7.4 | Yes |
a
Twofold or more regulation by EsaR according to RNA-Seq data. A, activation; R, repression.
b
Score generated using PATSER program (http://rsat.ulb.ac.be/rsat/patser_form.cgi) and published consensus (21).
c
Previously identified direct targets of EsaR, not analyzed by EMSAs in this study.
d
PLP, pyridoxal 5-phosphate.