TABLE 2.
Conditions for PCR amplifications
| Oligonucleotide class | Bacterial group/strain specificity | Gene (size, bp) | Oligonucleotide name | Oligonucleotide type | Oligonucleotide sequence | PCR conditions |
||
|---|---|---|---|---|---|---|---|---|
| Initial step | Amplification (35 cycles) | Final step | ||||||
| Generic | Rhizobiales | nifH (95) | nifH_UN_FW | Forward | CGGGCGTCGGNTGYGCNGG | 15 s at 95°C | 2 s at 98°C, 2 s at 65°C and 2 s at 60°C, 5 s at 72°C | 25 s at 72°C |
| nifH_UN_R | Reverse | CAAAGCCACCGCANACNACRTCNCC | ||||||
| nifH (350)a | KAD | Forward | CATCTTGTGGCGACCGCGATCTC | 15 s at 95°C | 2 s at 98°C, 2 s at 58°C and 2 s at 55°C, 20 s at 72°C | 25 s at 72°C | ||
| GEM | Reverse | ATSGCCATCATYTCRCCGGA | ||||||
| Rhizobium, Sinorhizobium, and Mesorhizobium | rpoB (786) | rpoB_RSM_FW | Forward | ACCCGCGATATTCCGAAYGTHTC | 15 s at 95°C | 2 s at 98°C, 2 s at 68°C and 2 s at 65°C, 25 s at 72°C | 30 s at 72°C | |
| rpoB_RSM_RV | Reverse | GTTCAGAACGACGTCGACRTG | ||||||
| Rhizobiales | nodC (384 bp) | nodC_FW_UNi2 | Forward | GATATGGAGTACTGGCTSGCNTG | 15 s at 95°C | 2 s at 98°C, 2 s at 65°C and 2 s at 60°C, 10 s at 72°C | 30 s at 72°C | |
| nodC_RV_UNi2 | Reverse | GTTCTGTCCGACGACGTCGAGCGTVAGRAASCG | ||||||
| Alphaproteobacteria | rpoB (740–752)b | Br3200F | Forward | TGAAGATGGTCAAGGTCTTCGT | 15 s at 95°C | 2 s at 98°C, 2 s at 60°C and 2 s at 55°C, 25 s at 72°C | 30 s at 72°C | |
| Br3950R | Reverse | GTCCGACTTSACHGTCAGCAT | ||||||
| Bacteria | 16S rRNA (1,300)c | 63F | Forward | CAGGCCTAACACATGCAAGTC | 15 s at 95°C | 2 s at 98°C, 2 s at 57°C and 2 s at 54°C, 30 s at 72°C | 30 s at 72°C | |
| L1401 | Reverse | GCGTGTGTACAAGACCC | ||||||
| Specific | S. americanum CCGM7 | rpoB (264) | rpoB_CCGM7_F2 | Forward | CTCGAGGCCTACCACGAGAGC | 15 s at 95°C | 2 s at 98°C, 2 s at 65°C and 2 s at 60°C, 10 s at 72°C | 30 s at 72°C |
| rpoB_CCGM7_R2 | Reverse | CGTCGCCTGTACGTCCGTCG | ||||||
| R. phaseoli CCGM1 | rpoB (290) | rpoB_CCGM1_FW | Forward | GATGTAGCCCACCGTGACC | 15 s at 95°C | 2 s at 98°C, 2 s at 65°C and 2 s at 60°C, 10 s at 72°C | 30 s at 72°C | |
| rpoB_CCGM1_RV | Reverse | CTTACAAGGCGAATGGCAAC | ||||||