TABLE 1.

Description of the oligonucleotide probes used for the FISH analysis

Probe	Positiona	Probe sequence (5′–3′)	Target	Reference(s)
Bac338I	338–355	GCTGCCTCCCGTAGGAGT	Domain Bacteria (positive control)	28, 32
Bac338II	338–355	GCAGCCACCCGTAGGTGT	Domain Bacteria (positive control)	32
Bac338III	338–355	GCTGCCACCCGTAGGTGT	Domain Bacteria (positive control)	32
Anti-Bac338	338–355	ACTCCTACGGGAGGCAGC	None (negative control)	32
Nso1225	1225–1244	CGCCATTGTATTACGTGTGA	Ammonia-oxidizing betaproteobacteria	29
NEU	653–670	CCCCTCTGCTGCACTCTA	Halophilic and halotolerant members of the genus Nitrosomonas	30
CTE	659–676	TTCCATCCCCCTCTGCCG	Competitor probe for NEU, unlabeled	30
6a192	192–212	CTTTCGATCCCCTACTTTCC	Nitrosomonas oligotropha lineage	31
c6a192	192–212	CTTTCGATCCCCGACTTTCC	Competitor probe for 6a192, unlabeled	31

^aPosition in the 16S rRNA of E. coli (42).