Table 1.

Molecular beacons and DNA sequences used for testing the immobilized SCF. Samples were synthesized by the Midland Certified Reagent Company Inc. Concentration of DNA solution used in the hybridization experiment is 100 nM.

Molecular Beacon
Wild-type MB:
5′-(HEX)AGCGGATGTTAAAGACCTATGCCGC(BHQ1-dT)(spacer 18)(3′-Biotin)-3′
Mutant-type MB:
5′-(HEX)AGCGGATGTTAAAAACCTATGCCGC(BHQ1-dT)(spacer 18)(3′-Biotin)-3′
DNA Sequences
Wild-type sequence: 5′-CATAGGTCTTTAACAT-3′
Mutant-type sequence: 5′-CATAGGTTTTTAACAT-3′