Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Oligos | Wildtype sequence (5′-3′) | Mutant sequence (5′-3′) | bp |
| 1 | cgagcgcctcagacaacaatagctae | cgagcgcctaaaacaacaatagctae | 26 |
| 2 | cgagcgcctcagacaacaatagctag | tcttaaaacaagtaatgctttgagca | 26 |
| 3 | aaagcactttttttaattgcagacae | aaagcactttttttaattgcaaaaae | 26 |
| 4 | ttcctgtgaatactttgtctagactt | ttcctgtgaatactttaaaaagactt | 26 |
