Table 2. Genome properties for predicted prophage and monocin regions in the genomes of five Listeria.
Name | Type | 5′ end | 3′ end | Size (bp) | % GC | ORFs | Span | Target | att site |
---|---|---|---|---|---|---|---|---|---|
L.monocytogenes F2365 φF2365.1 |
Monocin |
132 412 |
143 134 |
10 723 |
37.31 |
17 |
LMOf2365_0131–LMOf2365_0147 |
None |
None |
L.monocytogenes H7858 φH7858.1 |
Monocin |
159 262 |
169 984 |
10 723 |
37.30 |
17 |
LMOh7858_0138–LMOh7858_0154 |
None |
None |
L.monocytogenes H7858 φH7858.2 |
Prophage |
2 387 007 |
2 346 385 |
40 623 |
35.46 |
66 |
LMOh7858_2410–LMOh7858_2475 |
comK |
ggacg |
L.monocytogenes F6854 φF6854.1 |
Monocin |
142 468 |
153 188 |
107 21 |
37.20 |
17 |
LMOf6854_0126–LMOf6854_0142 |
None |
None |
L.monocytogenes F6854 φF6854.2 |
Prophage |
2 384 184 |
2 342 944 |
41 241 |
36.10 |
48 |
LMOf6854_2344–LMOf6854_2391 |
comK |
gga |
L.monocytogenes F6854 φF6854.3 |
Prophage |
2 697 390 |
2 658 558 |
38 833 |
35.68 |
52 |
LMOf6854_2652–LMOf6854_2703 |
tRNA-Thr-4 |
ttaagccacttgtcggatttgaaccgacgacc ccttccttaccatggaag |
L.monocytogenes EGD-e φEGDe.1 |
Monocin |
120 657 |
131 377 |
10 721 |
37.28 |
17 (18) |
lmo0113–lmo0129 |
None |
None |
L.monocytogenes EGD-e φEGDe.2 |
Prophage |
2 402 413 |
2 360 621 |
41 793 |
36.11 |
62 (68) |
lmo2271–lmo2332 |
comK |
gga |
L.innocua 11262 φ11262.1 |
Prophage |
76 060 |
115 548 |
39 489 |
37.28 |
58 (63) |
lin0071–lin0129 |
tRNA-Lys-4 |
actcttaatcagcgggtcgggggttcgaaaccctcacaacccatatat |
L.innocua 11262 φ11262.2 |
Monocin |
155 934 |
166 658 |
10 725 |
36.26 |
17 |
lin0160–lin0176 |
None |
None |
L.innocua 11262 φ11262.3 |
Prophage |
1 246 499 |
1 297 065 |
50 567 |
34.61 |
71 (81) |
lin1231–lin1302 |
Similar to lmo1263 |
aagtacacatca |
L.innocua 11262 φ11262.4 |
Prophage |
1 762 142 |
1 713 123 |
49 020 |
36.06 |
69 (81) |
lin1697–lin1765 |
Intergenic |
tatcccacaaaa[a/aa]tcccacaa |
L innocua 11262 φ11262.5 |
Prophage |
2 445 938 |
2 406 614 |
39 325 |
35.86 |
54 (64) |
lin2372–lin2426 |
comK |
gga |
L.innocua 11262 φ11262.6 | Prophage | 2 625 922 | 2 587 434 | 38 489 | 35.13 | 50 (63) | lin2561–lin2610 | tRNA-Arg-4 | atgccctcggaggga |
Note that the coordinates and predicted sizes of each region include sequences for putative core att sites. The number of ORFs was derived from the GenBank accessions for the two published genomes (8), but the number in parentheses reflects the number of predicted ORFs derived from a TIGR automated ORF prediction and annotation.