Table 3.
Clonal sequences at primer sites a
| Sequences at discriminative forward prime rs site (5′ − 3′) | Sequences at common reverse prime r site (5′ − 3′) | ||
|---|---|---|---|
| Primer V4b (M184V-specific) | GACATAGTTATCTATCAATICG* | Primer ASR2 (common reverse primer) | GGCTGTACTGTCCATTTATC |
| Primer VNc (non-specific) | ...................A. | ||
| Laboratory reference strains | |||
| HXB2 | ...................A.A | .................... | |
| pNL4.3 | ........C..........A.A | .................... | |
| Patient 1 clones | |||
| 10/12 | ......A.C..........A.. | .................... | |
| 1/12 | ......A.C..........A.. | .C.................. | |
| 1/12 | ......A.C..........A.. | ...................T | |
| Patient 2 clones | |||
| 2/12 | ......A.C..........A.. | ..T................. | |
| 2/12 | ...................A.. | ..T................. | |
| 2/12 | ...................A.. | .................... | |
| 2/12 | ......A............A.. | .................... | |
| 1/12 | ......A............A.. | .................G.. | |
| 1/12 | ........C..........A.. | .................... | |
| 1/12 | .....G.............A.. | .................... | |
| 1/12 | ......A............A.. | ..T................. | |
| Patient 3 clones | |||
| 9/12 | ..GC...............A.. | .................... | |
| 2/12 | ..GC...............A.. | ..T................. | |
| 1/12 | ...C...............A.A | .................... | |
| Patient 4 clones | |||
| 12/12 | .................G.A.. | .................... | |
Amplicons encompassing the 2218–3457 positions relative to the HXB2 laboratory reference strain, were obtained from patient plasma specimens, PCR-purified (QIAquick® PCR Purification Kit, QIAGEN Sciences, Maryland, USA), and cloned into a pGEM® T-Easy Vector (pGEM® T-Easy Vector System, Promega Corporation, Madison, WI, USA), as directed by the manufacturer. Twelve clonal pol sequences were obtained per patient before lamivudine interruption. Here, clonal sequences at the site of the discriminative primer set (left) and at the site of the common reverse primer (right) are presented. Respectively, the M184V-specific primer (V4) sequence and the ASR2 primer sequence are used as the reference sequence for patients’ clones.
In the M184V-specific primer (V4), the target mutation is shown in boldface, underlined and next to an asterisk, while the intentional A→I mismatch in the −2 position of the 3′ end is shown in boldface, italics and underlined.
The non-specific (VN) primer is one base pair shorter than the M184V-specific primer (V4) and does not incorporate an intentional mismatch.