Figure 1.

(A) Map of the lox phagemid display vector pDAN11. The Flag affinity tag and Lox 2372 site (ATAACTTCGTATAGGATACCTTATACGAAGTTAT; 13-bp inverted repeats are underlined) are located upstream of the scFv antibody gene, whereas the Lox WT (ATAACTTCGTATAGCATACATTATACGAAGTTAT) and SV5 affinity tags are located downstream of the scFv gene and upstream of the bacteriophage gene 3-coding sequence, resulting in display of the fusion protein. (B) Generic Lox Destination Vector. A negative selection marker (either Tet^r or sacB) is flanked by Lox 2372 and Lox WT, which, after exchange with the scFv gene, creates an in-frame fusion with the periplasmic leader sequence and the SV5 epitope and 6x His tags.