Skip to main content
. 2014 Oct 15;9(10):e110500. doi: 10.1371/journal.pone.0110500

Table 2. Description of the11 selected primers used for ISSR amplification.

No. Primer Sequences 5′→3′ Nt Np Pr % Ht Hs Gst
1 UBC825 (AC)8T 19 12 63.16 0.1715 0.0835 0.5132
2 UBC834 (AG)8YT 21 9 42.86 0.1035 0.0440 0.5748
3 UBC844 (CT)8AGC 22 11 50.00 0.1160 0.0517 0.5543
4 UBC845 (CT)8AGG 23 12 52.17 0.1192 0.0494 0.5855
5 UBC853 (CT)8AGT 20 9 45.00 0.1121 0.0352 0.6858
6 UBC855 (AC)8YT 21 11 52.38 0.1347 0.0645 0.5212
7 UBC857 (AC)8CTG 20 13 65.00 0.1763 0.0763 0.5672
8 UBC867 (GGC)6 19 10 52.36 0.1251 0.0564 0.5492
9 UBC873 (GACA)4 22 11 50.00 0.1165 0.0441 0.6214
10 UBC895 AGAGTTGGTAGCTCTTGATC 25 17 68.00 0.1875 0.0765 0.5920
11 UBC900 ACTTCCCCACAGGTTAACACA 29 20 68.97 0.2150 0.0773 0.6404
Sum 241 135
Mean 21.91 12.27 56.02 0.1434 0.0599 0.5823

Note: Nt-No. of total amplified bands; Np-No. of polymorphic bands; Pr-Polymorphism rate; Ht- Total gene diversity among population; Hs-within population diversity; Gst-Mean coefficient of gene differentiation.