Table 2. Description of the11 selected primers used for ISSR amplification.
No. | Primer | Sequences 5′→3′ | Nt | Np | Pr % | Ht | Hs | Gst |
1 | UBC825 | (AC)8T | 19 | 12 | 63.16 | 0.1715 | 0.0835 | 0.5132 |
2 | UBC834 | (AG)8YT | 21 | 9 | 42.86 | 0.1035 | 0.0440 | 0.5748 |
3 | UBC844 | (CT)8AGC | 22 | 11 | 50.00 | 0.1160 | 0.0517 | 0.5543 |
4 | UBC845 | (CT)8AGG | 23 | 12 | 52.17 | 0.1192 | 0.0494 | 0.5855 |
5 | UBC853 | (CT)8AGT | 20 | 9 | 45.00 | 0.1121 | 0.0352 | 0.6858 |
6 | UBC855 | (AC)8YT | 21 | 11 | 52.38 | 0.1347 | 0.0645 | 0.5212 |
7 | UBC857 | (AC)8CTG | 20 | 13 | 65.00 | 0.1763 | 0.0763 | 0.5672 |
8 | UBC867 | (GGC)6 | 19 | 10 | 52.36 | 0.1251 | 0.0564 | 0.5492 |
9 | UBC873 | (GACA)4 | 22 | 11 | 50.00 | 0.1165 | 0.0441 | 0.6214 |
10 | UBC895 | AGAGTTGGTAGCTCTTGATC | 25 | 17 | 68.00 | 0.1875 | 0.0765 | 0.5920 |
11 | UBC900 | ACTTCCCCACAGGTTAACACA | 29 | 20 | 68.97 | 0.2150 | 0.0773 | 0.6404 |
Sum | 241 | 135 | ||||||
Mean | 21.91 | 12.27 | 56.02 | 0.1434 | 0.0599 | 0.5823 |
Note: Nt-No. of total amplified bands; Np-No. of polymorphic bands; Pr-Polymorphism rate; Ht- Total gene diversity among population; Hs-within population diversity; Gst-Mean coefficient of gene differentiation.