TABLE 1.
Primera | Sequenceb | Use | Reference |
---|---|---|---|
FI3 | TCTTAGTTCCATGGGATGCTTTCTGTGTG | Long-range PCR, Southern blot probe cap110.58, sequencing of cap region, and in vitro translation of aliB-like ORF 1 | 11 |
FI4 | CGCTGAACTTTTGTAGTTGCTGTCTGGTCAAC | Long-range PCR and sequencing of cap region | 11 |
aliA_b832 | TGCAGGTTTGCTGGTATCTTGAC | Long-range PCR, Southern blot probe cap110.58, and sequencing of cap region | This study |
cpsA3 | ATCCTTGTCAGCTCTGTGTC | PCR for Southern blot probe cap111.46 | 14 |
cpsB2 | TCACTTGCAACTACATGAAC | PCR for Southern blot probe cap111.46 | 14 |
104_b832.12 | GTATCTGAACCTGATTGTCCGC | In vitro translation of aliB-like ORF 1 | This study |
110_FI3.4 | AACACTTGGAACGGAGAATG | PCR detection of aliB-like ORF 1 and RT-PCR | This study |
104_b832.14 | GCCCTTTGTTATACCTAGATGTTTC | PCR detection of aliB-like ORF 1 and RT-PCR | This study |
104_FI3.6 | AGATGCCAAATGGTTCACGG | PCR detection of aliB-like ORF 2 and PCR for Southern blot aliB-like ORF 2 probe | This study |
104_b832.10 | GAAATCTTTTAACAAATAAGGTCCG | PCR detection of aliB-like ORF 2 and PCR for Southern blot aliB-like ORF 2 probe | This study |
Rif-399f | GATGAYATCGAYCACCTCGGAAA | RT-PCR, control | 18 |
Rif-525r | GATGTTAGGTCCTTCAGGTGTCTC | RT-PCR, control | 18 |
dexB_f145_XbaI | GCTCTAGAGCTGGCTTTCTCCCGTTTATGACA | PCR for mutant construction | This study |
dexB_b1504_BamHI | CGGGATCCCGAGACAGATTTGACGTTTCCTTC | PCR for mutant construction | This study |
capN_F1_ClaI | CCATCGATGGTCGTTGGTGCTGGTTTGTCA | PCR for mutant construction | This study |
capN_B1_XhoI | CCGCTCGAGGCACTGCTTTGAGGTTGTAGATAA | PCR for mutant construction | This study |
cat_Spn_F1_HindIII | CCCAAGCTTGGATTTTTCGCTACGCTCAA | PCR for mutant construction | This study |
cat_Spn_B1_HindIII | CCCAAGCTTTCACTTATTCAGGCGTAGCACCAG | PCR for mutant construction | This study |
Primers used for primer walking sequencing of the different cap regions are not shown.
Recognition sites for restriction enzymes within the primers are underlined.