Table 1.
Primers used in this study
| Name | Sequence | Locationa | Directionb | Positiona |
|---|---|---|---|---|
| AQP1-7 | TCTCCTACCTGCCTCCATC | Intron 3 | Sense | 16469–16487 |
| AQP1-9 | CTTGGGGAAGTGACTTTGG | Exon 4 | Antisense | 16877–16895 |
| AQP1-11 | GCCTGATTTCCACTACCTGC | Intron 1 | Sense | 15036–15055 |
| AQP1-12 | GCCGTGTAGGCTTGCCTG | Intron 1 | Sense | 15054–15071 |
| AQP1-31 | CCTCCAGCAACCTCTTGTC | Intron 1 | Antisense | 5547–5565 |
| AQP1-35 | GTCGAGAAGTTTGGGAGC | Promoter | Sense | 4275–4292 |
a
Location and position of the primers based on NCBI AQP1 genomic Reference Sequence NG_007475.1.
b
Direction of the primers compared to the AQP1 transcript.