| No. | Primer name | Sequence 5′–3′ |
| 1 | dnj-14 del rev | TGCTCTCAACAGACCCATAC |
| 2 | dnj-14 del mid fwd | ATTCGCACGATCCGAAAAAG |
| 3 | dnj-14 del full fwd | CTGCATAGGGCACTCCTAGAAAT |
| 4 | tm3223 del full fwd | GCTTGTCTTACCTTATGTCGTCG |
| 5 | sir-2.1 del rev | CAGATAGTTCATACTGAAAATCT |
| 6 | sir-2.1 del fwd | AATCCCAATTGAACTCGCTG |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.