| Primer | Sequence | Annealing Temperature (°C) | Cycles | Assay |
| Prolactin (PRL) Forward | CATATTGCGATCCTGGAATGAGC | 60 | 40 | Sybrgreen |
| Prolactin (PRL) Reverse | TCCTCAATCTCTACAGCTTTGGA | 60 | 40 | Sybrgreen |
| Insulin-like growth factor binding protein 1 (IGFBP1) Forward | TCCTTTGGGACGCCATCAGTAC | 60 | 40 | Sybrgreen |
| Insulin-like growth factor binding protein 1 (IGFBP1) Reverse | GATGTCTCCTGTGCCTTGGCTA | 60 | 40 | Sybrgreen |
| GAPDH | Unspecified (see reagent list) | 60 | 40 | Taqman |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.