Skip to main content
. 2014 Oct 28;2:46. doi: 10.3389/fbioe.2014.00046

Table 2.

Oligonucleotides used in this work to identify and sequence the chromosomal locus of mini-Tn5 insertions.

Oligonucleotide Sequence (5′ → 3′) Use and reference
ARB6 GGCACGCGTCGACTAGTACNNNNNNNNNNACGCC Arbitrary PCR, round 1 (Pratt and Kolter, 1998)
ARB2 GGCACGCGTCGACTAGTAC Arbitrary PCR, round 2 (Pratt and Kolter, 1998)
pBAM-ME-I-Ext-R CTCGTTTCACGCTGAATATGGCTC Arbitrary PCR for pBAMD1-2, round 1 (Martínez-García et al., 2011)
pBAM-ME-I-Int-R CAGTTTTATTGTTCATGATGATATA Arbitrary PCR for pBAMD1-2, round 2, and sequencing (Martínez-García et al., 2011)
ME-O-Km-Ext-F CGTCTGTTTCAGAAATATGGCAT Arbitrary PCR for pBAMD1-2, round 1
ME-O-Km-Int-F ATCTGATGCTGGATGAATTTTTC Arbitrary PCR for pBAMD1-2, round 2, and sequencing
ME-I-Sm-Ext-R ATGACGCCAACTACCTCTGATA Arbitrary PCR for pBAMD1-4, round 1
ME-I-Sm-Int-R TCACCGCTTCCCTCATGATGTT Arbitrary PCR for pBAMD1-4, round 2, and sequencing
ME-O-Sm-Ext-F CTTGGCCTCGCGCGCAGATCAG Arbitrary PCR for pBAMD1-4, round 1
ME-O-Sm-Int-F CACCAAGGTAGTCGGCAAAT Arbitrary PCR for pBAMD1-4, round 2, and sequencing
ME-O-Gm-Ext-F GCACTTTGATATCGACCCAAGT Arbitrary PCR for pBAMD1-6, round 1
ME-O-Gm-Int-F TCCCGGCCGCGGAGTTGTTCGG Arbitrary PCR for pBAMD1-6, round 2, and sequencing
ME-I-Gm-Ext-R GTTCTGGACCAGTTGCGTGAG Arbitrary PCR for pBAMD1-6, round 1
ME-I-Gm-Int-R GAACCGAACAGGCTTATGTCA Arbitrary PCR for pBAMD1-6, round 2, and sequencing