Fig. 3.

Restriction enzyme accessibility assays (REM) using as few as 1,000 cells. Restriction enzyme accessibility of Pvu II at the promoter of a muscle-specific (desmin) or fat-specific (aP2) gene in differentiated muscle cells in the presence (−tet) or absence (+tet) of a dominant negative version of Brahma-related gene 1 (Brg1) was measured using tenfold serial dilutions of isolated nuclei. Accessibility was observed in the muscle-, but not the fat-specific promoter in a Brg1 dependent manner, as expected in a muscle cell. The amount of cleavage at each promoter site in the cells expressing dominant negative Brg1 was set to 1; the amount of cleavage in cells not expressing dominant negative Brg1 is expressed relative to that number. Primers to amplify desmin regulatory sequences were described (19). Primers for the aP2 promoter were 5' caaaatgtgtgatgcctttgtgg 3' and 5' tccatgcgggaagcagcattttc 3'.