Abstract
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Full text
PDF




Images in this article
Selected References
These references are in PubMed. This may not be the complete list of references from this article.
- Arai N., Nomura D., Villaret D., DeWaal Malefijt R., Seiki M., Yoshida M., Minoshima S., Fukuyama R., Maekawa M., Kudoh J. Complete nucleotide sequence of the chromosomal gene for human IL-4 and its expression. J Immunol. 1989 Jan 1;142(1):274–282. [PubMed] [Google Scholar]
- Fujita T., Takaoka C., Matsui H., Taniguchi T. Structure of the human interleukin 2 gene. Proc Natl Acad Sci U S A. 1983 Dec;80(24):7437–7441. doi: 10.1073/pnas.80.24.7437. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Huebner K., Isobe M., Croce C. M., Golde D. W., Kaufman S. E., Gasson J. C. The human gene encoding GM-CSF is at 5q21-q32, the chromosome region deleted in the 5q- anomaly. Science. 1985 Dec 13;230(4731):1282–1285. doi: 10.1126/science.2999978. [DOI] [PubMed] [Google Scholar]
- Lee J. S., Campbell H. D., Kozak C. A., Young I. G. The IL-4 and IL-5 genes are closely linked and are part of a cytokine gene cluster on mouse chromosome 11. Somat Cell Mol Genet. 1989 Mar;15(2):143–152. doi: 10.1007/BF01535075. [DOI] [PubMed] [Google Scholar]
- Maggi E., Del Prete G., Macchia D., Parronchi P., Tiri A., Chrétien I., Ricci M., Romagnani S. Profiles of lymphokine activities and helper function for IgE in human T cell clones. Eur J Immunol. 1988 Jul;18(7):1045–1050. doi: 10.1002/eji.1830180712. [DOI] [PubMed] [Google Scholar]
- McKenzie A. N., Li X., Largaespada D. A., Sato A., Kaneda A., Zurawski S. M., Doyle E. L., Milatovich A., Francke U., Copeland N. G. Structural comparison and chromosomal localization of the human and mouse IL-13 genes. J Immunol. 1993 Jun 15;150(12):5436–5444. [PubMed] [Google Scholar]
- Miyatake S., Otsuka T., Yokota T., Lee F., Arai K. Structure of the chromosomal gene for granulocyte-macrophage colony stimulating factor: comparison of the mouse and human genes. EMBO J. 1985 Oct;4(10):2561–2568. doi: 10.1002/j.1460-2075.1985.tb03971.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Miyatake S., Seiki M., Yoshida M., Arai K. T-cell activation signals and human T-cell leukemia virus type I-encoded p40x protein activate the mouse granulocyte-macrophage colony-stimulating factor gene through a common DNA element. Mol Cell Biol. 1988 Dec;8(12):5581–5587. doi: 10.1128/mcb.8.12.5581. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Miyatake S., Shlomai J., Arai K., Arai N. Characterization of the mouse granulocyte-macrophage colony-stimulating factor (GM-CSF) gene promoter: nuclear factors that interact with an element shared by three lymphokine genes--those for GM-CSF, interleukin-4 (IL-4), and IL-5. Mol Cell Biol. 1991 Dec;11(12):5894–5901. doi: 10.1128/mcb.11.12.5894. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mosmann T. R., Moore K. W. The role of IL-10 in crossregulation of TH1 and TH2 responses. Immunol Today. 1991 Mar;12(3):A49–A53. doi: 10.1016/S0167-5699(05)80015-5. [DOI] [PubMed] [Google Scholar]
- Nimer S. D., Morita E. A., Martis M. J., Wachsman W., Gasson J. C. Characterization of the human granulocyte-macrophage colony-stimulating factor promoter region by genetic analysis: correlation with DNase I footprinting. Mol Cell Biol. 1988 May;8(5):1979–1984. doi: 10.1128/mcb.8.5.1979. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sanderson C. J., Campbell H. D., Young I. G. Molecular and cellular biology of eosinophil differentiation factor (interleukin-5) and its effects on human and mouse B cells. Immunol Rev. 1988 Feb;102:29–50. doi: 10.1111/j.1600-065x.1988.tb00740.x. [DOI] [PubMed] [Google Scholar]
- Shannon M. F., Gamble J. R., Vadas M. A. Nuclear proteins interacting with the promoter region of the human granulocyte/macrophage colony-stimulating factor gene. Proc Natl Acad Sci U S A. 1988 Feb;85(3):674–678. doi: 10.1073/pnas.85.3.674. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Smith D. L., Johnson A. D. A molecular mechanism for combinatorial control in yeast: MCM1 protein sets the spacing and orientation of the homeodomains of an alpha 2 dimer. Cell. 1992 Jan 10;68(1):133–142. doi: 10.1016/0092-8674(92)90212-u. [DOI] [PubMed] [Google Scholar]
- Staynov D. Z., Lee T. H. Expression of interleukin-5 and granulocyte-macrophage colony-stimulating factor in human peripheral blood mononuclear cells after activation with phorbol myristate acetate. Immunology. 1992 Jan;75(1):196–201. [PMC free article] [PubMed] [Google Scholar]
- Sugimoto K., Tsuboi A., Miyatake S., Arai K., Arai N. Inducible and non-inducible factors co-operatively activate the GM-CSF promoter by interacting with two adjacent DNA motifs. Int Immunol. 1990;2(8):787–794. doi: 10.1093/intimm/2.8.787. [DOI] [PubMed] [Google Scholar]
- Tanabe T., Konishi M., Mizuta T., Noma T., Honjo T. Molecular cloning and structure of the human interleukin-5 gene. J Biol Chem. 1987 Dec 5;262(34):16580–16584. [PubMed] [Google Scholar]
- Warrington J. A., Bailey S. K., Armstrong E., Aprelikova O., Alitalo K., Dolganov G. M., Wilcox A. S., Sikela J. M., Wolfe S. F., Lovett M. A radiation hybrid map of 18 growth factor, growth factor receptor, hormone receptor, or neurotransmitter receptor genes on the distal region of the long arm of chromosome 5. Genomics. 1992 Jul;13(3):803–808. doi: 10.1016/0888-7543(92)90156-m. [DOI] [PubMed] [Google Scholar]
- Woodrow M., Clipstone N. A., Cantrell D. p21ras and calcineurin synergize to regulate the nuclear factor of activated T cells. J Exp Med. 1993 Nov 1;178(5):1517–1522. doi: 10.1084/jem.178.5.1517. [DOI] [PMC free article] [PubMed] [Google Scholar]




