FIG 6 .
Insertion frequencies within homopolymer regions of MARV-Ang NP and L from the adrenal glands of infected macaques. Pie charts depict the numbers of adenosine residues at the novel locations within the MARV-Ang L ORF detected in RNA extracted from infected macaque mRNA. The numbers of A residues were enumerated within the homopolymer region from sequencing reads with 10 nt of matching sequence (underline in the sequence) directly flanking each side from positions 17799 to 17825 (GCTCAAATGCAAAAAACTCAGAATGG). (A) Homopolymer insertion frequency in MARV-Ang NP mRNA at 9 dpi within adrenal gland, determined from an amplicon encompassing the region of interest. (B) Homopolymer insertion frequency in MARV-Ang L mRNA at 9 dpi within adrenal gland, determined from an amplicon encompassing the region of interest.