Table 3.
Mutation frequency by electroporating expression vectors of sgRNA and Cas9†
| Target gene | Name of sgRNA | Sequence of the recognition site in DNA‡ | Mutation frequency (in %) | n§ |
|---|---|---|---|---|
| Ci-Hox3 | wt Hox3-sg3¶ | GGCAGCCATAAGAGTCAACA | 36.3 | 22 |
| Ci-Hox5 | wt Hox5-sg1 | GGCGACGACGGGTTAGGTAA | 46.2 | 26 |
| Hox5-sg1/-G | GCGACGACGGGTTAGGTAA | 56.3 | 16 | |
| Hox5-sg1/-GG | CGACGACGGGTTAGGTAA | 0 | 15 | |
| Hox5-sg1/+A | AGGCGACGACGGGTTAGGTAA | 10.7 | 28 | |
| Hox5-sg1/+TA | TAGGCGACGACGGGTTAGGTAA | 3.1 | 32 | |
| Hox5-sg1/+ATC | ATCGGCGACGACGGGTTAGGTAA | 0 | 29 | |
| Hox5-sg1/+ATCA | ATCAGGCGACGACGGGTTAGGTAA | 0 | 14 |
†Twenty micrograms of sgRNA and 40 μg of Cas9 expression vectors were simultaneously electroporated. ‡Nucleotides added at the junction between U6 promoter were shown in red. §Number of sequenced polymerase chain reaction (PCR) clones. ¶wild type (wt) indicating the standard 20-nt recognition sites of the sgRNAs.