Table 4.
Mutation frequency at the putative off-target sites of Hox3-sg3†
| Name of sites | Sequence of the target site in DNA‡ | Mutation frequency (in %) | n§ |
|---|---|---|---|
| On-target | GGCAGCCATAAGAGTCAACA | 58.0¶ | 31 |
| Off-target 1 | GGCAcCCATAtcAGTCAACt | 0 | 16 |
| Off-target 2 | GaCAaCCATAAGAGaCcACA | 0 | 16 |
| Off-target 3 | tcCAGCCATAAGAGTCtAtA | Not examined |
†3.0 pg of sgRNA and 15 pg of Cas9 mRNA were microinjected. ‡Mismatched nucleotides are shown in lower case. §Number of sequenced clones. ¶The score is the same as that shown in Table2.