Table 5.
Mutation frequency by sgRNAs that contain single base mismatches at the recognition site
| Target gene | Name of sgRNA | Method of introduction | Sequence of the recognition site in RNA† | Mutation frequency (in %) | n‡ |
|---|---|---|---|---|---|
| Ci-Hox5 | wt Hox5-sg1§ | Microinjection of 3.0 pg of sgRNA and 15 pg of Cas9 mRNA | GGCGACGACGGGUUAGGUAA | 75.9¶ | 31 |
| Mismatch1 | GGCGcCGACGGGUUAGGUAA | 3.3 | 30 | ||
| Mismatch2 | GGCGACGcCGGGUUAGGUAA | 0 | 31 | ||
| Mismatch3 | GGCGACGACGuGUUAGGUAA | 0 | 28 | ||
| Mismatch4 | GGCGACGACGGGUgAGGUAA | 6.7 | 29 | ||
| Mismatch5 | GGCGACGACGGGUUAGuUAA | 0 | 30 | ||
| Mismatch6 | GGCGACGACGGGUUAGGUAc | 0 | 31 | ||
| Ci-Hox3 | wt Hox3-sg3§ | Electroporation of 20 μg of sgRNA and 40 μg of Cas9 expression vectors | GGCAGCCAUAAGAGUCAACA | 36.3¶ | 22 |
| Mismatch1 | GGCAGCCcUAAGAGUCAACA | 0 | 23 | ||
| Mismatch2 | GGCAGCCAUAcGAGUCAACA | 13.6 | 22 | ||
| Mismatch3 | GGCAGCCAUAAGAuUCAACA | 0 | 24 | ||
| Mismatch4 | GGCAGCCAUAAGAGUCcACA | 0 | 24 | ||
| Mismatch5 | GGCAGCCAUAAGAGUCAACc | 0 | 24 |