Table 3.
Primers used for analysis of the unique sequence element (USE) detected in Katablepharis CRE.
| Primer name | Sequence (5′→3′) | Target group | rRNA gene region | Research question | Reference |
|---|---|---|---|---|---|
| Kj3F | TGGATCGAAAGGTCTGGGTA | Katablepharidaceae | SSU | 1 | This study |
| Kj281R | TCCTCTGACTTCACCCTGCT | Katablepharidaceae | LSU | 1 | This study |
| 528f | CCGCGGTATTCCAGCTC | Eukaryota | SSU | 2 | Elwood et al. (1985) |
| K28VR6 | CCAACGGCAACAATTGACTA | Katablepharis CRE | LSU-USE | 2, 3 | This study |
| K28VF6 | GGAATTAGGCCAGCATCAGA | Katablepharis CRE | LSU-USE | 3 | This study |
| ORF1 | GACTCCTTGGTCCGTGTTTCAAGA | Eukaryota | LSU | 2 | This study |
| ORF2 | CGAACAAGTACCGTGAGGGAAAGATGCAAA | Eukaryota | LSU | 2 | This study |
Research question refers to the questions discussed in the introduction.