Table 1.
Sequences and concentrations of primers used for quantitative PCR
| Gene (Accession) | Forward primer, concentration | Reverse primer, concentration |
|---|---|---|
| Actin 97 (TC164213) | atgttcccgggtattgctgacaga, 0.4 | ctgcctttgcaatccacatctgct, 0.4 |
| AGPase (AY186620) | ggagtccgattcaatgtgagaagaag, 0.4 | ccaaaacactccggctagcatc, 0.4 |
| GBSS (EU403426) | tacacaagagtggaacccagcgac, 0.4 | tgtcaacaggcaagccaactgc, 0.4 |
| INH (FJ810207) | caccctacaatccgatccacgta, 0.4 | tcgccacgtaacactggctaagt, 0.4 |
| SPS (BQ510597) | tccacaggtcgcaagagtatcagg, 0.8 | ccggataaaacacttcgctcccac, 0.2 |
| SuSy (AJ537575) | tttgaggcctggtgtctgggaataca, 0.4 | tccattcgaggctccgtcgacaa, 0.4 |
| VInv (TC163068) | aaacgggttggacacatcat, 0.2 | aacccaattccacaatccaa, 0.2 |
All sequences are given 5′-3′, and concentrations are μM. Abbreviations: AGPase ADP-glucose pyrophosphorylase small subunit, GBSS granule-bound starch synthase, INH invertase inhibitor 3, SPS sucrose phosphate synthase 2, SuSy sucrose synthase 4, VInv vacuolar acid invertase. Accessions for Actin 97 and VInv are from the Gene Index Project; all others are from GenBank.