Skip to main content
. 2014 Aug 23;11:148. doi: 10.1186/s12974-014-0148-9

Table 1.

Sequence of specific primers used for quantitative real-time reverse transcription PCR

Gene Sequence
CNPase Forward gcaggaggtggtgaagagat
Reverse cagatggcttgtccagatca
TNF-α Forward cgtcagccgatttgctatct
Reverse cggactccgcaaagtctaag
IL-1β Forward gcccatcctctgtgactcat
Reverse aggccacaggtattttgtcg
iNOS Forward gcttgtctctgggtcctctg
Reverse ctcactgggacagcacagaa
β-actin Forward ggattccatacccaagaagga
Reverse gaagagctatgagctgcctga

CNPase, 2′,3′-cyclic nucleotide 3′-phosphodiesterase; IL-1β: interleukin-1beta; iNOS, inducible nitric oxide synthase; PCR, polymerase chain reaction; TNF-α, tumor necrosis factor alpha.