Table 2.
Primer pairs for PCR amplifications of three chloroplast DNA regions displaying polymorphism in the Olea europaea complex (G. Besnard, R. Rubio de Casas and P. Vargas, unpubl. res.)
| cpDNA region |
Primer sequence (5′–3′) |
Fragment name |
T (°C) |
Polymorphism type |
Fragment size (bp) |
|---|---|---|---|---|---|
| trnT-L | F: CATTCCTCCGCTTTCATTCG | trnT-L-poly-A | 53 | LP; Poly A | 106, 107 |
| R: TATGTCTCTCTTCCTGCCAC | |||||
| matK | F: ATATCCACTTATCTTTCAGGAG | matK-2-TaqI/MseI | 53 | RS; TaqI | 101 → 101 (–) |
| R: TGGATTTATTGTCATAACCTGG | → 63 + 38 (+) | ||||
| RS; MseI | 101 → 101 (–) | ||||
| → 54 + 47 (+) | |||||
| matK | F: AGATAGTAAAATCTCATAATTTTC* | matK-3-TaqI | 53 | RS; TaqI | 102 → 102 (−) |
| R: GGGGTATTAGTATATCTAACAC | → 24 + 78 (+) |
The fragment names, size variants, polymorphism types and annealing temperatures (T) are given.
*
The bold nucleotide indicates a nucleotide change comparatively to the reference sequences (A→T) to create an absence–presence polymorphism of a TaqI restriction site.
LP, Length polymorphism; RS, restriction site polymorphism (nucleotide substitution); (−), absence of the restriction site; (+), presence of the restriction site.