Fig. 4.

Complementary sequences (C.S., 135 bp in length) in intron 14 & 16 and the locations of the primers designed to target the mutation sites. The locations of the primers are indicated with arrows: (1) Brca2e14-42 F (5′-CCGCACCTGGTCAAGAATTTC); (2) Brca2e14-242R (5′-CTAACACACTGTTCAACTCTGTG); (3) Brca2i14-216 F (5′-CAATCTAGGACTGCTGTTACTGGA); (4) Brca2i14-699 F (5′-AGGAGAGCATGTAAACTTCGAG); (5) Brca2e15-10R (5′-CTCTGGCATTCTGAAGACTTG); (6) Brca2e16-143 F (5′-TCATACCCTCCAATGATGGAAAG); (7) Brca2i16-864R (5′-TACGGGCATGCATCACCATAC); (8) Brca2i16-1161R (5′-TAAGTGGGATTGCAGGCGCGTG). Primer pairs of (1)&(2), (3)&(7), (3)&(8), (4)&(7), (4)&(8), (4)&(5), (6)&(7) had been used for PCR reaction. The primer pair of (3)&(7) gave rise to an abnormal PCR product in patient's samples. Sequencing the abnormal PCR product indicated that the elements of IVS14-491 ~ IVS14-512 and IVS16-441 ~ IVS16-462 (Black boxes) were identical (i.e., ggaggctgaggcaggagaatcg), and the mutant allele lost 2,596 nucleotides in total, including one of the elements and the sequence in between