Fig. 5.

PCR on cord blood DNA. PCR was performed with BRCA2i14-216 F & BRCA2i16-636R (A, 5′-TCCTGTGCTCAAGAGATCTGC), BRCA2i14-216 F & BRCA2i16-864R B, or HBA-F & HBA-R (C, 5′- GCGATCTGGGCTCTGTGTTCT, and 5′- GTTCCCTGAGCCCCGACACG). If the DNA templates contain the mutant allele, 486 bp and 714 bp PCR products should be obtained, respectively. The additional primer of BRCA2i16-636R was designed and applied in order to reduce a possible misdiagnosis due to non-specific amplification. The primer C was complimentary to hemoglobin alpha gene and the PCR product was 312 bp, which was used to indicate the presence of genomic DNA templates in each reaction. Lane 1 ~ 2, patient (mutant allele carrier); lane 3, patient' sister (normal); lanes 4 ~ 5, baby; lanes 6, unrelated normal; lane 7, H2O. As ADO with genomic DNA has never been reported, negative findings should demonstrate the baby's normal condition