Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences for conventional PCR.
| Primers | Sense primer (5’-3’) | Antisense primer (5’-3’) |
| TEM-1 | gtggcttcgagtgttattg | gaagagctccggatatttg |
| TEM-2 | agccatgatgaagactttgt | cttgaggtcactgttgacg |
| TEM-6 | acccgtgacgtcattttc | tgtacttgcttcgagcatc |
| TEM-7 | ggagcaggtcacgatgag | gtgaaactgcccttgtctt |
| TEM-7R | cttgattggcagtatggagt | gagatgtacatggtcccact |
| TEM-8 | catttcaagttgtcgtgaga | gacgcatattgttgttgaga |
