Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequences of primers for mutagenesis reaction.
| Primer | Direction | Length | Position (nt) | 5’-sequence-3’ |
| A1762/G1764For | + | 34 | 1748-1781 | aggagattagttaaaggtctttgtactaggaggc |
| 1896/1899Rev | - | 20 | 1895-1876 | aaagccacccaaggcacagc |
| A1896For | + | 31 | 1876-1906 | gctgtgccttgggtggctttagggcatggac |
| A1899For | + | 34 | 1876-1909 | gctgtgccttgggtggctttgggacatggacatt |
| A1896A1899For | + | 34 | 1876-1909 | gctgtgccttgggtggctttaggacatggacatt |
| PS5For | + | 20 | 1260-1279 | gccgatccatactgcggaac |
| PS4Rev | - | 20 | 2386-2405 | gagaccttcgtctgcgaggc |
