Skip to main content
. Author manuscript; available in PMC: 2014 Dec 2.
Published in final edited form as: Connect Tissue Res. 2014 Aug;55(0 1):29–32. doi: 10.3109/03008207.2014.923862

Figure 2.

Figure 2

F2r analyses. Top: RT-PCR of PAR1–PAR4 transcripts from enamel organ epithelia (EOE) of Day 7 mouse molars. PCR conditions were: annealing 58 °C for 30 s; extention at 72 °C for 1 min; 25 cycles. The primers used were: PAR1, F: ctcctcaaggagcagaccac, R: tgcagggactaatgggattc; PAR2, F: tgtgattggtttgcccagta, R: tcgtgacaggtggtgatgtt; PAR3, F: ttctgccagtcactgtttgc, R: ctcgccaaatacccagttgt; PAR4, F: gctggtgctgcactattcaa, R: cacatagcccagcctagctc. Bottom: PAR1 Immunohistochemistry on D14 mandibular incisor. Key: Am, ameloblasts; Od, odontoblasts.