Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Single-nucleotide polymorphisms (SNPs) at locus EM74.7 in Arabis alpina in the independent data set of the Swiss Alps. Given are the SNP marker names, nucleotide base changes, haplotype frequencies, single-base extensions (SBE) primers including the poly(T) tail and primer length (bp)
| Marker | SNP | Haplotype frequency | SBE extension primer | Size [bp] |
|---|---|---|---|---|
| 1b | G | 0.733 | GATAAAAAGAGTGCAGAGAATTCA | 24 |
| T | 0.267 | |||
| 3f | A | 0.733 | (T)26CCAGTTGCAACAAGTG | 42 |
| G | 0.267 | |||
| 4 h | A | 1.000 | (T)17GAGGTCTCAGTGGTTTTA | 35 |
| C | 0.000 |
