TABLE 3.
Transcription factors from both of the databases JASPAR and TRANSFAC
| Serial no. | Rank | Matrix no. | Name of position-specific matrix in databasesa | P valueb | Sequencec |
|---|---|---|---|---|---|
| 1 | 1 | M01549 | F$CUP9_01 | 0.00742 | TCCTCAATGTGTCAATTAAC |
| 2 | MA0288.1 | CUP9 | 0.00791 | AATGTGTCA | |
| 2 | 3 | M01030 | F$RIM101_01 | 0.0176 | CCAAGCTA |
| 3 | 4 | M01621 | F$SOK2_01 | 0.0278 | GCCTGCAACT |
| 5 | MA0385.1 | SOK2 | 0.0329 | TATATGCATGCG | |
| 4 | 6 | MA0350.1 | TOD6 | 0.0341 | ATTTTTCCCTCATCGGCACAT |
| 5 | 7 | M01523 | F$PHD1_01 | 0.0343 | ATGCTTATATGCATGCGCATA |
| 6 | 8 | M01534 | F$TEC1_01 | 0.0345 | TTGCCAAAATTCTTGCTTTC |
| 7 | 9 | M01537 | F$DOT6_01 | 0.0355 | ATTTTTCCCTCATCGGCACAT |
| 10 | MA0351.1 | DOT6 | 0.0363 | ATTTTTCCCTCATCGGCACAT | |
| 8 | 11 | MA0398.1 | SUM1 | 0.0424 | TTAATTTAT |
a
Names beginning with âFâ are from the TRANSFAC database; all other names are from the JASPAR database.
b
Probability of observing a certain or higher affinity in a given sequence. An accurate P value computation for the TRAP tool scores allows determination of which factors are the most likely to regulate a given target gene. It is set to normalize an observed affinity for a random-sequence model and to give a statistical meaning to the statement that one factor binds stronger than another.
c
Sequence of the transcription factor binding site.