Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences for real-time polymerase chain reaction
| Gene | Primer sequence (5′-3′) |
|---|---|
| Bax | F: aagctgagcgagtgtctcaag |
| R: caaagtagaaaagggcgacaac | |
| Bcl-2 | F: gtttgatttctcctggctgtctc |
| R: gaaccttttgcatatttgtttgg | |
| p53 | F: ggtaatctactgggacggaacagc |
| R: attctccatccagtggtttcttctt | |
| MDM2 | F: cattgaaccttgtgtgatttgtc |
| R: gcagggcttattccttttctt ta | |
| GAPDH | F: ggcacagtcaaggctgagaatg |
| R: atggtggtgaagacgccagta |
Abbreviations: F, forward; R, reverse.
