Table 1.
Primers, phage, bacterial strains, and plasmids used in this study
| Name | Characteristics / function | Source |
|---|---|---|
| P1 | GGATCCATGATTCTGACTAAAGACGGGTT | Beijing Genomics Institution |
| P2 | CTCGAGCTATAAGCTCCGTAGAGCGC | Beijing Genomics Institution |
| OXA-51-F | TAATGCTTTGATCGGCCTTG | Beijing Genomics Institution |
| OXA-51-R | TGGATTGCACTTCATCTTGG | Beijing Genomics Institution |
| BL21(DE3) | Expression host for recombinant plasmid | Purchased from Sangon Biotech |
| pET28a | Expression vector (kanamycin resistant) | Our laboratory collection |
| pET28a-plyAB1 | Recombinant vector (kanamycin resistant) | This study |
| Abp1 | Phage of AB1. Isolated from hospital sewage | Our laboratory collection |
| AB001-AB040 | XDRAB. Isolated from the Southwest Hospital of Chongqing. China | Our laboratory collection |
| JM109 | E. coli strain for testing host range | Our laboratory collection |
| BL21 | E. coli strain for testing host range | Our laboratory collection |
| N315 | S. aureus strain for testing host range | Our laboratory collection |
| PAO1 | P. aeruginosa strain for testing host range | Our laboratory collection |