Table 1.

Mamu/Mafa/Mane-A2 locus-specific amplification and sequencing primers

Primer ID	Annealing Site	Sequence (5′-3′)	Application
P000044	Sense 5′ UT	GATTCTCCGCAGACGCCCA	Paired with P000023 for PCR
P000023	Antisense Exon 5	GGAGAACCAGGCCAGCAAT	Paired with P000044 for PCR
P000076	Sense Intron 1	GAGCAGCGACGGGACCGCA	Exon 2 sequencing (forward)
P000060	Antisense Intron 2	CCTGGGGCTCTCCCGGGTCA	Exon 2 sequencing (reverse)
P000096	Sense Intron 2	TGTACTGAGTCTCCCTGATGG	Exon 3 sequencing (forward)
P000098	Antisense Intron 3	TTCATTCCCTCAGAGATTTT	Exon 3 sequencing (reverse)
P000055	Sense Intron 3	CCCAGGTRCCTSTGTCCAGGA	Exon 4 sequencing (forward)
P000294	Antisense Intron 4	CTCTGGGAAAGGAGGGGA	Exon 4 sequencing (reverse); Mamu
P000281	Antisense Intron 4	AGAGGGGAAAGTGAGGGGT	Exon 4 sequencing (reverse); Mane & Mafa

Note: Unless otherwise specified, primers are useful for all three species