TABLE 1.
Target | Primer or probe | Sequence (5′-3′)h | Nucleotides within targeta | Product size (bp) | Annealing temp (°C) | Tm (°C) |
---|---|---|---|---|---|---|
rpoB | TR9 | TCGCCGCGATCAAGGAGTb | 2335-2352 | 158 | 62 | 61.0 |
TR8 | GTGCACGTCGCGGACCTCCAb | 2492-2473 | 68.4 | |||
rpo sensorc | 640-ACCCACAAGCGCCGACTGCTGG-Pd | 2412-2432 | 70.4 | |||
rpo anchorc | TTCATGGACCAGAACAACCCGCTGTCGGT-F | 2379-2407 | 73.8 | |||
RPO1 sensore | CAGCTGAGCCAATTCATGGACC-F | 2367-2388 | 65.2 | |||
RPO1 sensore | 640-AACAACCCGCTGTCGGGG | 2390-2407 | 65.2 | |||
katG | TB86 | GAAACAGCGGCGCTGATCGTb | 2759-2778 | 209 | 67 | 64.3 |
TB87 | GTTGTCCCATTTCGTCGGGGb | 2968-2948 | 62.8 | |||
TB sensorc | 640-TCACCAGCGGCATCGAGGTCGT-Pd | 2916-1937 | 69.4 | |||
TB anchorc | CGTATGGCACCGGAACCGGTAAGGACGC-F | 2886-2913 | 75.3 | |||
TaqMan MGB probes | FAM-ACCAGCGGCATCG-Q | 2918-2930 | 66.3 | |||
VIC-TCACCACAGGCATCG-Q | 2916-2930 | 65.1 | ||||
VIC-ACCACCGGCATCG-Q | 2918-2930 | 64.9 | ||||
inhA | TB92 | CCTCGCTGCCCAGAAAGGGAf | 56-75 | 248 | 64 | 65.2 |
TB93 | ATCCCCCGGTTTCCTCCGGTf | 303-284 | 66.5 | |||
TB ATTg | 640-CCCGACAACCTATCATCTCGCC-Pd | 223-202 | 63.1 | |||
TB anchorg | CCCCTTCAGTGGCTGTGGCAGTC-F | 248-226 | 68.1 |
The positions of the primers and probes correspond to GenBank accession numbers L27989, X68081, and U66801 for the rpoB gene, the katG gene, and the inhA locus, respectively.
Primer sequence described by Telenti et al. (23).
Probe sequence described by Torres et al. (25).
P, phosphorylation of the 3′ end of the probe to prevent extension during PCR.
Probe sequence described by Garcia de Viedma et al. (7).
Primer sequence described by Gonzalez et al. (8).
Probe sequence described by Torres et al. (26).
Fluorophores were as follows: 640, Red 640; F, fluorescein; FAM, 6-carboxy-fluorescein; Q, quencher (TAMRA [6-carboxy-N,N,N′,N′-tetramethylrhodamine]); VIC, fluorescent reporter. For TaqMan MGB probes, designed to detect wt codon 315 of katG (AGC) and two mutations (ACA and ACC), these sequences are underlined.