. 2014 Dec 2;6(12):3223–3237. doi: 10.3390/toxins6123223

Table 1.

Primer sequences used to amplify amino-modified detector DNA and an internal real-time PCR target sequence.

Primers	Oligonucleotide sequences (5'-3')	Modification	PCR product size	Application of PCR product
pGL2A_Fwd	NH₂-(C₆)-GTTCGTCACATCTCATCTAC	5'-amino	560-bp	Tethered via SMCC to anti-AFB1 antibodies
pGL2A_Rev	TCGGGTGTAATCAGAATAGC	None	560-bp	Tethered via SMCC to anti-AFB1 antibodies
pGL2B_Fwd	GAACTGCCTGCGTCAGATTC	None	101-bp	Real-time PCR fragment for quantification
pGL2B_Rev	AACCGTGATGGAATGGAACAAC	None	101-bp	Real-time PCR fragment for quantification