Skip to main content
. Author manuscript; available in PMC: 2015 Jan 5.
Published in final edited form as: Yeast. 2008 May;25(5):321–326. doi: 10.1002/yea.1590

Figure 3.

Figure 3

PFGE karyotypes of marked diploids, haploid parents and disomic strains selected by MARV. (A) Proper localization of the KanMX marker in heterozygous esg::KanMX/ESG starter diploids for chromosomes I, IX, X or XIV. Intact chromosomes were separated using 60 s pulses and stained with ethidium bromide (left). The gel was blotted and hybridized to 32P multi-prime™(GE Healthcare, Piscataway, NJ, USA) -labelled KanMX DNA probe (right). Probe DNA was amplified from plasmid PJT, using forward 5′-TCAGGTGCGACAATCTATCGAT and reverse 5′- CTCACCGAGGCAGTTCCATAG primer sequences. Lane A, strain DZ11 (Chr. I); lane B, strain DZ12 (Chr. IX); lane C, strain DZ13 (Chr. X); lane D, strain DZ14 (Chr. XIV). Asterisks denote esg::KanMXtargeted chromosomes. (B) PFGE analysis of Chr. I disomic strains. Intact chromosomes from G418RCanRHis+ spore colonies were separated using 25 s pulses and the fluorescent band intensities quantitated. Chr. I copy number shown below each lane was determined by comparing the relative band intensities of Chr. I and VI within the same strain and correcting for the size difference between the two chromosomes. Lanes 1–10, MARV-selected Chr. I disomes; lane M, Lambda Ladder PFG Marker (New England BioLabs, Ipswich, MA, USA); lanes P1 and P2, haploid parents of starter diploid DZ10, showing euploid karyotypes. (C) PFGE analysis of Chr. I, IX, X and XIV disomic strains. Intact chromosomes from G418RCanRHis+ spore colonies were separated using 60 s pulses and the fluorescent band intensities quantitated. Lane A, Chr. I; lane B, Chr. IX; lane C, Chr. X; lane D, Chr. XIV. P1 and P2 are the same as in lane B. Determination of chromosome copy number: for each aneuploid (lanes A–D), band intensities of five chromomes (I, IX, XI, X, XIV) were quantitated and the results normalized against the corresponding band intensities in the haploid parent control (lane P2). Band intensities of the two haploid parents (P1 and P2) were similarly compared to ensure euploidy P1/P2. The adjacent Radar chart constructed using Excel (Microsoft, Redmond, WA, USA) shows the ratio of each quantitated chromosome for aneuploids (A–D) and haploid (P1) with respect to the haploid control (P2).