Table 2.
NanoPCR and conventional PCR target gene and primers used for amplification of MEV
| Primer name a | Length (nt) | Genome position b | Sequence (5′-3′) | Melting temperature (°C) | Product (bp) |
|---|---|---|---|---|---|
| P1 | 20 | 1906-1925 | ACAAGCGGCAAGCAATCCTC | 54.9 | 194 |
| P2 | 20 | 2080-2099 | CTGCCTCTATTTCGGACCAT | ||
| P3 | 23 | 151-173 | CGCCATGTCTGGCAACCAGTATA | 56 | 2013 |
| P4 | 25 | 2139-2163 | GGTTAATCCAAGTCGTCTCGAAAAT |
aP1 and P2 were used to amplify a portion of the NS1 gene (194 bp). P3 and P4 were used to amplify the full-length MEV NS1 gene (2,013 bp).
bThe nucleotide positions of the nanoPCR and conventional PCR primers are according the genome sequence of mink enteritis virus strain MEVB (GenBank accession number FJ592174).