Table 1. Molecular markers, primers and PCR conditions used in this study.
Marker | Primers | Conditions |
---|---|---|
LSU | CLA-F (5’- GCATATCAATAAGCGGAGGA); CLA-R (5’- GACTCCTTGGTCCGTGTTTCA) [7] | 2 min of denaturation at 95°C, 40 cycles consisting of 30 s at 95°C, 60 s at 62°C, 90 s at 72°C and 5 min of extension at 72°C [19] |
tef1 | EF6–20F (5’-AAGAACATGATCACTGGTACCT-3’); EF6–1000R (5’-CGCATGTCRCGGACGGC-3’) [10] | 96°C for 3 min, 35 cycles at 96°C for 30 s, 61°C for 45 s and a final extension step at 72°C for 1 min [53] |
ITS | ITS4 (5’-TCCTCCGCTTATTGATATGC-3’); ITS5 (5’-GGAAGTAAAAGTCGTAACAAGG-3’) [54] | 96°C for 3 min, 35 cycles at 94°C for 1 min, 55°C for 1 min and a final extension step at 72°C for 2 min [54] |