Generation of L-cells in mouse and human small intestine organoids

Abstract

Upon a nutrient challenge, L-cells produce glucagon-like peptide 1 (GLP-1), a powerful stimulant of insulin release. Strategies to augment endogenous GLP-1 production include promoting L-cell differentiation and increasing L-cell number. Here we present a novel in vitro platform to generate functional L-cells from 3D cultures of mouse and human intestinal crypts. We show that short-chain fatty acids (SCFAs) selectively increase the number of L-cells resulting in an elevation of GLP-1 release. This is accompanied by up-regulation of transcription factors, associated with the endocrine lineage of intestinal stem cell development. Thus, our platform allows us to study and modulate the development of L-cells in mouse and human crypts as a potential basis for novel therapeutic strategies in type 2 diabetes.

Impairment of insulin secretion is a hallmark of type 2 diabetes. New strategies in the treatment of type 2 diabetes are based on the glucose-lowering effects of the intestinally produced hormone glucagon-like peptide 1 (GLP-1), which augments glucose-dependent insulin release, improves beta-cell survival and promotes satiety (1-3). GLP-1 producing L-cells are scattered in the intestinal epithelium among enterocytes and other secretory cells. They also produce GLP-2 and peptide YY. GLP-1 is released in response to ingested nutrients and is rapidly degraded by the enzyme dipeptidyl peptidase 4 (DPP4). Current antihyperglycemic agents include inhibitors of DPP4, which enhance bioavailability of endogenously secreted GLP-1, and GLP-1 receptor agonists.

Alternatively, increasing the L-cell number to augment GLP-1 secretion can be a useful therapeutic strategy. L-cells are generated from stem cells at the base of intestinal crypts. The intestinal stem cells proliferate and give rise to transit amplifying progenitor cells that subsequently differentiate (4). Enteroendocrine cells and cells from other secretory cell lineages, such as goblet and Paneth cells, originate from a common progenitor cell (5-7). Later in differentiation, endocrine cell progenitors express Neurogenin 3 (8). Insight in the development of L-cells and determination of factors and downstream signaling pathways that drive L-cell differentiation is hampered by the lack of an in vitro system that allows the study of L-cells in their regular cell environment. Therefore, we applied a three-dimensional intestinal crypt culture system developed recently in our institute (9). In this system, intestinal crypts are grown as self-renewing organoids that continuously produce differentiated epithelial cells, including chromogranin-A positive cells, similar to intestinal crypts in vivo (4, 9, 10). So far it has not been established whether these chromogranin-A positive cells in organoids are representative of L-cells in vivo.

Here we show a continuous generation of mouse and human L-cells in vitro, with a possibility to observe L-cell development in real time and selectively modulate the generation of L-cells by nutrient stimulation with short chain fatty acids.

RESEARCH DESIGN AND METHODS

Animals

Animal experiments were conducted under the approval of the animal care committee of the Royal Netherlands Academy of Arts and Sciences, (permit number HI 11.2503). 12-Weeks old C57BL/6 mice were purchased from Charles River (L’Arbresle, France). Mice expressing YFP under transcriptional control of the proglucagon promotor (GLU-Venus mice, ref. 11) were bred on a C57BL/6 background in our animal facility. Mice were fed regular chow ad libitum.

Human tissue

Surgically resected intestinal tissues or endoscopic biopsy samples were obtained from the University Medical Centre Utrecht. Informed consent was provided by all subjects. The study was approved by the ethical committee of the University Medical Centre Utrecht.

Crypt isolation

Mouse and human intestinal crypts were isolated from mouse and human jejunum as described previously (9, 12, 13) and seeded into Matrigel [BD Biosciences], in which they grow into organoids (9, 13). Crypts were cultured in Advanced DMEM/F12 containing 100 U/ml penicillin/streptomycin, 10 mM HEPES, 2 mM Glutamax, supplements N2 (1×) and B27 (1×), 50ng/ml murine or human EGF (for mouse and human crypt culture, respectively) [all from Life Technologies], 1 μM N-acetylcysteine [Sigma-Aldrich], and murine Noggin and human R-spondin-1 both as 10% conditioned medium (13). The culture medium for human crypts was additionally supplemented with 50% Wnt-3A conditioned medium (13), 10 nM gastrin [Sigma-Aldrich], 10mM nicotinamide [Sigma-Aldrich], 500 nM inhibitor of transforming growth factor beta type I receptor ALK5 kinase (A83-01) [Tocris], and 10 μM p38 mitogen-activated protein kinase inhibitor (SB202190) [Sigma-Aldrich] (13). The medium was refreshed every 2-3 days. Mouse and human colon crypts (Suppl. Data) were cultured using the same medium composition as human jejunum. Analysis of human and mouse organoids was done on 1.5 or 2-month-old cultures. For passage, organoids were removed from the Matrigel, mechanically dissociated using a glass Pasteur pipette, pelleted and re-plated in fresh Matrigel in 24-well plates. Mouse organoids were passaged every 5 days with a 1:4 splitting ratio. Human organoids were passaged every 10-14 days with a 1:8 split ratio. To test the effect of SCFAs on L-cell differentiation, a combination of acetate, propionate and butyrate (5mM, 1mM and 1mM, respectively) was added to the culture medium. These SCFA concentrations were chosen based on earlier in vitro studies (14) and the ratios of these fatty acids in plasma and intestinal lumen (15). For control mouse organoids, regular medium without SCFAs was used. For dose testing in Figure S2F, different concentrations of SCFA combination were used with a constant ratio of 5:1:1 for acetate:butyrate:propionate, respectively.

To improve differentiation of human organoids during SCFAs testing, Wnt-3A, nicotinamide, A-83-01 and SB202190 inhibitor were omitted (13). Human and mouse organoids were collected for analysis 48 hours after SCFA addition.

Immunostaining and 5-ethynyl-2′-deoxyuridine (EdU) labeling

For immunostaining organoids were fixed in 4% paraformaldehyde, permeabilized with 0.3% Triton X and blocked with 3% donkey serum. Organoids were overnight incubated with primary antibodies against GLP-1 (Phoenix Pharmaceuticals), mucin (Santa Cruz, sc-15334), lyzozyme (Dako, A0099), chromogranin A (ChgA) from Santa Cruz, sc-1488, or chromogranin C (ChgC) from Santa Cruz, sc-1491, at 4 C°. Alexa Fluor 568 donkey anti-goat and Alexa Fluor 488 donkey anti-rabbit (Invitrogen) were used for as secondary antibodies. Images were acquired on a confocal laser-scanning microscope (Leica, SP5) using LAS software. The percentage of L-cells in organoids was determined based on the number of L-cells and DAPI-positive cells in 3 Om optical slices from Z-stacks with a distance of 3 μm between the slices. For EdU labeling, mouse organoids were incubated in 10 μM EdU (Click-it, Invitrogen) for 30 min and human organoids 2 hours before fixation. The detection was done according to manufacturer’s protocol.

qPCR analysis

Total RNA was extracted from organoids using Trizol (Invitrogen) and reverse-transcribed with Fermentas kit. Quantitative real-time PCR was performed on a real-time PCR System (Bio-Rad) using SYBR green assays. We tested GAPDH, HPRT and Beta 2 microglobulin (B2M) as endogenous control gene and found B2M to be most stable during organoid culture and passaging (data not shown). Gene expression of L-cell specific functional markers (11) was analyzed in sorted L-cells from organoids, fresh villi and crypts. Markers of intestinal cell types were analysed in whole organoids (Table 1). Transcription factors associated with L-cell development were tested in whole organoids and sorted L-cells.

TABLE 1.

Quantitative RT-PCR primers. Primers were generated using Primer 3 software. Relative expression values were derived using delta delta CT method with beta 2 microglubulin (B2M) as endogenous reference.

Gene	Species	Alias	Forward	Reverse
Beta-2 microglobulin	Mouse	B2m	CTGGTGCTTGTCTCACTGAC	GTTCAGTATGTTCGGCTTCC
Preproglucagon	Mouse	Gcg	GCTTATAATGCTGGTGCAAG	TTCATCTCATCAGGGTCCTC
Sodium-glucose linked transporter 1	Mouse	Sglt1	CAAAGTGACCACTTCCAATG	GTACCGTTGGAGGCTTCTTC
Glucokinase	Mouse	Gck	TGAAGACGAAACACCAGATG	GTCCAGGAAGTCAGAGATGC
Glut5, fructose transporter	Mouse	SLC2A5	CCAATATGGGTACAACGTAGC	TTCTGTCGTAGTAGGTGTCATTG
Sodium channel, voltage-gated, type III, alpha subunit	Mouse	Scn3a	TCGATTCAGTGCCACCTC	ATTCTTCGTCCAGTCAGGAG
K+ voltage-gated channel, subfamily S, 2	Mouse	Kcns2	GCACACAGACAAGCACTCAC	GGTCATGCTGGAGATGC
Calcium channel, voltage-dependent, P/Q type, alpha 1A subunit.	Mouse	Cacna1a	ACAACATCCTGTTTGCTGTG	CAACCAGTTCCAAGTGTTCC
Free fatty acid receptor 2	Mouse	Ffar2	ACCAGAGGAGAACCAGGTAG	CGTGAGGATCAAGGAACTG
Secretin	Mouse	Sct	CTGCTGCTCTCCAGTTCC	CTCGCTGGTGAACATTCC
Tryptophan hydroxylase	Mouse	Tph	TGGACAGCTGAGAGTCTTTG	CAAAGGGCTTGACTTTGG
Gastric inhibitory polypeptide (glucose-dependent insulinotropic peptide)	Mouse	Gip	TGAAGACCTGCTCTCTGTTG	CTGCGTACCTTGGACCTC
Chromogranin A	Mouse	ChgA	TTCCATGCAGGCTACAAAG	GTCTTTCCATCTCCATCCAC
Lysozyme 1	Mouse	Lyz1	GGAATGGATGGCTACCGTGG	CATGCCACCCATGCTCGAAT
Intestinal trefoil factor	Mouse	ITF	CCTCTGGCTAATGCTGTTG	CAGTCCACTCTGACATTTGC
Leucine-rich repeat containing G protein-coupled receptor 5	Mouse	Lgr5	CTTTGACACACATTCCCAAG	AAATTCTGTAGCGCTTCCTC
Prominin 1	Mouse	CD133 (Prom1)	ATGCAGGAGGAAGTGCTTG	AGTCCTGGTCTGCTGGTTAG
Intestinal fatty acid binding protein	Mouse	I-Fabp	CGGCACGTGGAAAGTAGACC	AATGGTCCAGGCCCCAGTGA
Neurogenin 3	Mouse	Ngn3	GCATGCACAACCTCAACTC	TTTGTAAGTTTGGCGTCATC
Neurogenic differentiation factor 1	Mouse	Neurod1	AGGTGGTACCTTGCTACTCC	TGAAAGAGAAGTTGCCATTG
Aristaless related homeobox factor	Mouse	Arx	GTTACCAGCTGGAGGAACTG	GGCCTCTGTCAGGTCCAG
Forkhead box A2, transcript variant 1	Mouse	FoxA1/2	GAGCCATCCGACTGGAG	ATGTGTTCATGCCATTCATC
Beta-2 microglobulin	Human	B2M	GCGCTACTCTCTCTTTCTGG	GCTGGATGACGTGAGTAAAC
Preproglucagon	Human	GCG	CAAGGCAGCTGGCAACGT	CAAGGCAGCTGGCAACGT
Secretin	Human	SCT	CACTCAGACGGGACGTTCAC	ATGCTGTTCTCTGCGTCCTG
Tryptophan hydroxylase	Human	TPH	TGCGGACTTGGCTATGAACT	GGAATACGGTTCCCCAGGTC
Gastric inhibitory polypeptide (glucose-dependent insulinotropic peptide)	Human		GGCAGTGGGACTAGGAGAGA	GGCTGCTCACCTTAGCATGA
Chromogranin A	Human	CHGA	ACTCCGAGGAGATGAACGGA	CTTGGAGAGCGAGGTCTTGG
Lysozyme 1	Human	LYZ1	CGCTACTGGTGTAATGATGG	TTTGCACAAGCTACAGCATC
Intestinal trefoil factor	Human	ITF, TFF3	CTTGCTGTCCTCCAGCTC	CAGTCCACCCTGTCCTTG
Leucine-rich repeat containing G protein-coupled receptor 5	Human	LGR5	GAGAAAGCATTTGTAGGCAAC	ATCTCCCAACAAACTGGATG
Prominin 1	Human	CD133	GTCCTGGGGCTGCTGTTTAT	TCCACCACATTTGTTACAGCA
Intestinal fatty acid binding protein 2	Human	I-FABP, FABP2	CACAGTCAAAGAATCAAGCAC	TCGTTTCCATTGTCTGTCC
Neurogenin 3	Human	NGN3	AGTTGGCACTGAGCAAGC	AGTGCCGAGTTGAGGTTG
Neurogenic differentiation factor 1	Human	NEUROD1	TGAGACTATCACTGCTCAGG	CACTCTCGCTGTACGATTTG
Aristaless related homeobox factor	Human	Arx	GTGTGGGCTGTCTCAGG	CGACACCCAGCTTTCATC
Forkhead box A2, transcript variant 1	Human	FoxA1/2	GGGAGCGGTGAAGATGGA	TCATGTTGCTCACGGAGGAGTA

Villus and crypt L-cell isolation and FAC-sorting

For comparison of primary and organoid-derived L-cells, freshly isolated small intestine crypts from GLU-Venus mouse and small intestine GLU-Venus mouse organoids after 5-8 passages were dissociated with 0.05% trypsin-EDTA (Life Technologies) at 37°C into single cells, centrifuged in 4% FBS in PBS at 300g and immediately sorted by flow cytometry. Villi were collected from intestinal fragments prior to crypt isolation, washed in PBS containing 10% FBS and dissociated into single cells as described for crypt cell isolation. YFP-positive cells were separated by flow cytometry as described previously (11).

Time lapse imaging

YFP fluorescence and bright field images of GLU-Venus mouse organoids in a glass-bottom 24-well plate were made every 3 hours during 3 days using a wide field Leica AF7000 microscope (Leica Microsystems) equipped with a thermostatic chamber with humidity control and 5% CO₂.

GLP-1 secretion assay

Basic medium for static incubations contained Hanks Buffered Salt Solution (Life technologies) supplemented with 10mM HEPES, 0.1% fatty acid-free bovine serum albumin and no glucose, pH 7.4 (NaOH). Organoids from 24-well plates were collected in 1.5ml Eppendorf tubes (one well per tube) and incubated in the basic medium for two hours in a thermomixer at 300 rpm. Then organoids were washed and incubated in 50 μl of basic medium containing 1 mg/ml diprotin A (Sigma Aldrich) for 1 hour. The supernatant was collected and the organoids were incubated in 50 μl of 10 mmol/l glucose in basic medium with diprotin A for one hour followed by collection of the supernatant. Organoids were then lysed in CelLytic M buffer (Sigma-Aldrich). GLP-1 concentrations in the organoid cell lysates and supernatants were determined by Multi-Species GLP-1 total ELISA (Millipore) and Human Total GLP-1 multi-array (Meso Scale Diagnostics). DNA was extracted from the organoid cell lysate (16) and quantified using the PicoGreen kit (Invitrogen). GLP-1 content was normalized to the DNA content of organoids.

Statistical analysis

All data are expressed as means ± SEM. One-way ANOVA with post hoc Tukey’s tests was used for comparison of dose testing for the SCFA combination and expression of genes associated with GLP-1 secretion in sorted L-cells. For comparison of basal and stimulated GLP-1 secretion data, the Kholmogorov-Smirnov test was applied. Student’s non-paired t-test was used for all other comparisons. Significance level was set at p<0.05.

RESULTS

L-cells are generated in organoids derived from murine and human intestinal crypts

Small intestinal crypts formed organoids that consisted of several outwardly protruding crypt domains and a central villus domain (Fig. 1A, 1B and S1A-B). In accordance with the cell composition of crypts in vivo, the crypt domain in organoids consisted of a crypt base, containing stem cells and Paneth cells, a zone of dividing multipotent transit-amplifying cells and differentiating cells, such as goblet cells and enteroendocrine cells (ref. 16 and Fig. S1A-F and S2B). The villus domain mostly consisted of absorptive and secretory cells (17, 18), and showed a spheroid or oval-shaped structure in mouse organoids (Fig. 1A), containing mostly non-dividing cells (Fig. S1A). Human organoids formed fold-like extensions (Fig. 1B) and the central part of the organoid often had many single dividing cells (Fig. S1B). Human organoids showed mucin- and lysozyme-positive cells but no clearly defined lysozyme granules or mucin droplets, characteristic for Paneth and goblet cells (Fig. S1D and S1F). Mouse organoids had 5.2±0.3 crypt domains per organoid 4 days after passage and human organoids had 11.1±0.4 crypt domains per organoid 10 days after passage. L-cells, identified as GLP-1 immunoreactive cells, were mostly found in crypt regions as single cells that were polarized towards the exterior basal side of the organoids (Fig. 1C and 1D). In mouse organoids, L-cells constituted 0.5±0.05 % of all organoid cells, which corresponds to 2.1±0.1 cells per average-sized organoid (ranging from 0 to 15 cells depending on organoid size). The organoids generated L-cells at a relatively constant rate for 48-96h after splitting (Fig. S2F). In human organoids, GLP-1 positive cells constituted 0.1±0.001 % of all organoid cells, or 1.5±0.03 cells per organoid. Following a 30 min EdU pulse, no double positive cells for GLP-1 and EdU were found in a total of 300 human or mouse organoids (data not shown), indicating that mature L-cells do not divide. Free fatty acid receptor 2 (FFAR2) appeared exclusively on GLP-1 positive cells (Fig. S2A). GLP-1 immunoreactive cells also expressed vesicle markers ChgA and ChgC (Fig. S2B and S2C, respectively). These characteristics were still present in L-cells from 6-month-old cultures of mouse organoids (data not shown).

FIG. 1.

A: Mouse organoids embedded in Matrigel and cultured for 4 days. B: Human organoids in Matrigel, cultured for 10 days. C, D and E: L-cells in organoids are indentified by GLP-1 immunostaining (green). Scale bars: 20 μm.

GLU-Venus mice express YFP in intestinal L-cells under the control of the proglucagon promoter (11). Intestinal organoid cultures from these mice provided a unique opportunity to monitor real-time L-cell development (Fig. 2A). The majority of L-cells appeared near the crypt base and moved away from the crypt base concomitantly with a proliferative expansion of the transit amplifying compartment. The fluorescence disappeared 3-4 days (Fig.2A) after first becoming detectable indicating loss of glucagon promoter activity or L-cell death. The disappearance of the fluorescent signal is unlikely to reflect photobleaching, as the cells were only excited for 70 ms every 3 h. As >90% of labeled cells were double positive, when Venus expressing organoids were immunostained for GLP-1 (data not shown), the fluorescent time course is likely to reflect the turn-over of GLP-1 expressing cells

FIG. 2.

A: Development of an L-cell in an organoid crypt. A picture of the same organoid was taken at different time points during culture. White arrow indicates the position of a group of Paneth cells at the crypt base. Scale bars: 20 μm. B: Gene expression in FAC-sorted primary L-cells from crypts, villi and organoid-derived L-cells: preproglucagon gene (Gcg), sodium-glucose linked transporter 1 (Sglt1), free fatty receptor 2 (Ffar2), fructose transporter 5 (Glut5), glucokinase (Gck), a major subunit of the ATP-sensitive K+ channel (Kir6.2), sodium channel, voltage-gated, type III, alpha subunit (Scn3a), calcium channel, voltage-dependent, P/Q type, alpha 1A subunit (Cacna1a). Data is gene expression determined by the ΔΔCT method with beta 2 microglobulin (B2m) as endogenous control presented as mean ± SEM, n is number of experiments from 4-6 samples for organoid derived L-cells and 4 samples of primary L-cells from different mice. **P<0.01, by one-way ANOVA with post hoc Tukey’s test.

To test whether in vitro generated L-cells are functionally mature, we used GLU-Venus mice to compare FAC-sorted primary L-cells from small intestine and L-cells from organoids after 6 passages. Estimated by FAC-sorting, the percentage of L-cells in the organoids was similar to that observed in fresh small intestine crypts (Fig. S2H) and was in line with our calculations based on microscopy. We compared gene expression of specific functional markers in L-cells isolated from organoids and from freshly prepared villi and crypts (Fig.2B). Proglucagon gene expression was higher in L-cells from villi compared to L-cells from crypts and organoids (Fig. 2B). We found that Sglt1, Glut5, Gck, Ffar2, Kcnq1, Scn3a, Kir6.2 and Cacna1a expression was maintained in organoid-derived L-cells, indicating that L-cells produced in our cultures retain the molecular profile of their counterparts in vivo and express stimulus-secretion coupling components for GLP-1 release.

We further analyzed the expression of transcription factors associated with L-cell development (8, 19-23) in L-cells from organoids and from freshly prepared crypts (Figures S3A-D). Organoid L-cells had a similar expression pattern to crypt-derived L-cells and showed reduced expression of Ngn3 compared to whole organoids, consistent with its role as early endocrine marker (8)..

Short-chain fatty acids increase the number of L-cells and GLP-1 secretion in mouse and human small intestine organoids

SCFAs are known to stimulate GLP-1 secretion and we tested their effect on L-cell development. The addition of SCFAs as a combination of 5mM acetate, 1 mM propionate and 1 mM butyrate almost doubled the number of L-cells in mouse (Fig. 3A-B) and human organoids (Fig. 3C) within 48 hours. We tested several concentrations of the combination of the three SCFA (Fig. S2F) and found that lower concentrations of SCFAs did not increase L-cell number. Concentrations of SCFAs higher than those used above did not result in a further increase in L-cell number (NS, by one-way ANOVA). Propionate and butyrate (but not acetate) in concentrations higher than 1 mM had a toxic effect resulting in changes in organoid morphology and reduction of growth (data not shown). Increasing the acetate levels alone did not have an additional effect on L-cell numbers (data not shown).

FIG. 3.

Effect of SCFA on L-cell numbers in small intestine organoids. A: Mouse SCFA-treated organoids (c-d) produce more GLP-1 positive cells than control organoids (a-b). Z-stack projections of 20 optical slices covering the entire organoid. Scale bar: 20 μm. B and C: Number of L-cells increased after 48h of SCFA treatment (5 mM acetate, 1 mM propionate and 1 mM butyrate). Here and in the following figures, white bars = control, black bars = SCFA-treated. D and E: SCFAs increased total GLP-1 content of organoids. F and G: SCFA-mediated increase in GLP-1 secretion. Data is presented as mean ± SEM, n is number of experiments from 3 independent platings for each series.

The increase in L-cell number was accompanied by a higher GLP-1 content in mouse and human organoids (Fig. 3D-E). To test whether SCFA treatment generates nutrient-responsive L-cells, we measured glucose-induced GLP-1 secretion. In SCFA-treated mouse organoids, both basal and stimulated GLP-1 secretion was higher than in control (Fig. 3F). Both control and SCFA-treated mouse organoids showed a 2-fold increase in GLP-1 release during stimulation with 10mM glucose (Fig. 3F), indicating that this effect was due to the increased number of L-cells but not to the ability to increase GLP-1 release during the nutrient challenge. Human organoids showed very low basal secretion (Fig. 3G), consistent with fewer L-cells. There was a two-fold increase in GLP-1 secretion from control organoids upon glucose stimulation (Fig. 3G). After the SCFA treatment, both basal and stimulated GLP-1 secretion from human organoids were increased (Fig. 3G).

To test the effect of SCFA on differentiation of the other cell lineages, we performed marker gene expression analysis (Fig. 4A and 4C, Table 1). In mouse and human organoids, SCFA treatment had no effect on expression of Lgr5 and CD133 (markers for stem cells and early progenitors respectively, ref. 18), ITF (goblet cells), Lys1 (Paneth cells) or I-FABP (enterocytes), but the pan-endocrine cell marker ChgA was increased during SCFA treatment. In accordance with our data on GLP-1 content, Gcg expression was elevated in mouse and human organoids compared to the control. Gene expression of the enterochromaffin cell marker Tph or the K-cell marker Gip did not change in mouse organoids after SCFA treatment indicating a specific induction of L-cell differentiation (Fig. 4A). In human organoids, the expression of SCT and TPH was increased (Fig. 4C). Next, to evaluate the potential of organoids to generate L-cells, we analysed gene expression of the transcription factors Ngn3 (19, 20), Neurod1 (21), Foxa1/2 (22) and Arx (23) associated with early and late L-cell development in organoids. In mouse and human organoids gene expression of Neurod1 and Foxa1/2 was upregulated but not expression of Ngn3 or Arx (Fig. 4B and 4D). Some transcription factors that regulate cell development are also expressed after cell maturation and may be involved in the maintenance of the mature state of the cell. Therefore, we also compared the expression of transcription factors in the pure L-cell fraction from control and SCFA-treated mouse organoids and found no differences (Fig. 4E).

FIG. 4.

A and B: Expression of main intestinal cell type markers in organoids after SCFA treatment: preproglucagon gene (Gcg), secretin (Secr), tryptophan hydroxylase (TPH), glucose-dependent insulinotropic peptide (Gip), chromogranin A (ChgA), lysozyme (Lys1), intestinal trefoil factor (ITF), stem cell/progenitor markers Lgr5 and CD133 and the enterocyte marker intestinal fatty acid binding protein (I-FABP). C and D: Effect of SCFAs on transcription factors associated with L-cell development in whole organoids: Ngn3, neurogenic differentiation factor 1 (Neurod1), aristaless related homeobox factor (Arx), forkhead box 1/2 (Foxa1/2). Data is gene expression determined by the ΔΔCT method with beta 2 microglobulin (B2m) as endogenous control presented as mean ± SEM, n is number of experiments from 4 platings for mouse organoids and 3 independent platings for human organoids. E: Expression of transcription factors associated with L-cell development in sorted L-cells from control and SCFA-treated organoids. Data is relative gene expression determined by the ΔΔCT method and presented as mean ± SEM, n=5 for control organoids from 5 platings and n=3 for SCFA-treated organoids from 2 platings. *P<0.05.

DISCUSSION

The main findings of our study are that L-cells can be continuously generated from murine and human intestine in a 3D culture system, which allows real-time studies of L-cell development. Using organoid culture of GLU-Venus mouse crypts, we were able to observe “birth” of L-cells within a crypt environment in vitro and study gene expression from in vitro-derived L-cells. The number of L-cells can be selectively modulated by nutrient factors (SCFAs). This illustrates the use of this novel platform to investigate factors that modulate the L-cell number and function in order to increase endogenous GLP-1 production for the treatment of patients with type 2 diabetes.

The number of L-cells in organoids was close to that observed in freshly isolated mouse small intestinal crypts and villi. The majority of L-cells were in crypt domains of the organoids, similar to reports in freshly isolated tissue, where L-cells are also found mainly in crypts and lower villi (24). It is assumed that in vivo the cells from the crypt region are being “pushed” towards the villus by dividing transit amplifying cells, and then shed from the surface of the villus. In the organoids, the “villus” space is smaller and is “shared” among several crypts (9), so the migration patterns of cells in organoids may not mimic the situation in intact intestine. Whilst we did not observe major expression differences for most L-cell markers in cells derived from murine organoids or fresh tissue, proglucagon was expressed at significantly higher levels in villus L-cells. A possible explanation is an increase of proglucagon expression as L-cell mature during the migration from the crypts to the villus top. Other factors predominantly present in the crypt environment, such as Wnt- and Notch signaling may suppress cell differentiation. This might be of special importance in the human organoid cultures, where differences in culture medium may interfere with the establishment of a distinct crypt-villus axis and may also directly affect enteroendocrine cell maturation consistent with the observed lower L-cell density.

L-cells from our mouse and human organoid cultures co-express neuroendocrine granule markers ChgA and ChgC and the free fatty acid receptor 2, and are able to secrete GLP-1 in response to nutrient stimulation. The increase in GLP-1 secretion during glucose stimulation was comparable to that reported in previous studies on mouse primary L-cells (11). Similar expression of genes associated with stimulus-secretion coupling for GLP-1 release in primary L-cells and L-cells from organoids further indicates that the organoid system is an excellent model for the generation of functioning L-cells. It has some advantages over the established systems, because L-cells in organoids are retained in a polarized environment and can be monitored over their entire life span. In addition, organoids can be established from human tissue. Organoids thus have substantial potential for translational studies and drug testing, particularly for drugs targeting L-cell differentiation.

Earlier in vivo studies on animals reported that dietary fiber increase GLP-1 levels (25-28) and colonic L-cell numbers (29, 30). This effect was attributed to the production of SCFAs by intestinal microflora during the fermentation of fiber (30). SCFAs have been shown to elevate the proglucagon gene in rat intestine (28, 31). In our in vitro system, SCFAs enhanced L-cell differentiation in mouse and human small intestinal crypts. Increased proglucagon gene expression, elevated GLP-1 content and glucose-stimulated increase in GLP-1 secretion in mouse and human organoids indicate that L-cells generated during SCFA-treatment are functional. Importantly, SCFAs did not change the organoid growth pattern or expression of stem cell, goblet cell and Paneth cell markers. The effect of SCFAs was selective to L-cells in mouse organoids because pan-endocrine marker ChgA gene levels increased, but markers of other endocrine cell types (Sct, Tph and Gip) did not change. Human SCFA-treated organoids showed an up-regulation of TPH and SCT, indicating an additional effect on enterochromaffin EC cells and S-cells, respectively. Whilst some overlap in secretin and GLP-1 expression has been observed in mice (32, 33), enterochromaffin cells are thought to derive through a lineage distinctive from L-cells and we did not observe any co-localisation of serotonin and GLP-1 in human organoids (data not shown). It is thus possible that, at least in human organoids, SCFA increase maturation to different enteroendocrine cell types. It should be remembered, that L-cells co-express a number of different hormones, including CCK, GIP and PYY, with GIP being more prevalent in the proximal small intestine and PYY increasing towards the distal intestine (32, 34). Therefore, although an increase in L-cell secretion may be beneficial for glucose control in type 2 diabetes, the concomitant stimulation of a range of gut peptides could lead to additive anorexic, but also unwanted side effects, as for example overstimulation of the exocrine pancreas and the gallbladder. Dissection of the pathway by which SCFAs enhance L-cell development could provide valuable knowledge on how to enhance naturally regulated GLP-1 production from L-cells in duodenum, jejunum, ileum and colon. By EdU staining we found no dividing L-cells regardless whether organoids were treated with SCFAs or not (data not shown). This indicates that existing L-cells do not contribute to increased L-cell numbers and that SCFAs likely affect endocrine progenitors in the organoids. Ngn3 defines the endocrine commitment of a secretory cell progenitor (8, 19, 20) and, consistent with that, we found that the expression of Ngn3 is lower in mature L-cells than in whole organoids that also contain a population of early endocrine-committed cells. SCFAs did not change the gene expression of Ngn3 in whole organoids, but increased expression of transcription factors Neurod1 and Foxa1/2 which are downstream of Ngn3 and have been specifically associated with L-cell development (21, 22). Based on this, we suggest that SCFAs act on late enteroendocrine precursors of L-cells, in which expression of Ngn3 is already fading (20). SCFA treatment did not have additional effects on the expression of transcription factors in sorted L-cells. FFAR2 mediates the stimulatory effect of SCFAs on GLP-1 secretion (14), however, it remains to be established whether it is involved in L-cell differentiation. Because SCFAs are GLP-1 secretagogues, it is possible that persistent activation of existing L-cells may stimulate the development of L-cells in surrounding areas.

In conclusion, the self-renewing 3D intestinal crypt culture system allows production of functional L-cells and can be used to study L-cell development and their changes in (patho)physiological conditions that can be modeled in vitro. It is a promising platform for compound screening and studies on L-cell function. We demonstrate that L-cell differentiation can be selectively increased by SCFAs. Further identification of the signaling mechanisms induced by SCFAs may be a useful tool in our pursuit for better treatments for type 2 diabetes and obesity.

Abbreviations

GLP-1

glucagon-like peptide 1

SCFA

short-chain fatty acid

DPP4

enzyme dipeptidyl peptidase 4

EdU

5-ethynyl-2′-deoxyuridine

ChgA

chromogranin A

ChgC

chromogranin C

Gcg

preproglucagon

Tph

tryptophan hydroxylase

GIP

glucose-dependent insulinotropic peptide

Lgr5

leucine-rich repeat-containing G-protein coupled receptor 5

Lys

lysozyme

ITF

intestinal trefoil factor

Muc

mucin

I-FABP

intestinal fatty acid binding protein

Secr

secretin; neurogenin 3

Ngn3

Neurod1 neurogenic differentiation factor 1

Foxa1/2

forkhead box A 1/2

Arx

aristaless related homeobox factor

B2M

beta 2 microglubulin

FFAR2

free fatty acid receptor 2

PYY

peptide YY