. 2015 Jan 27;5:8056. doi: 10.1038/srep08056

Table 2. Primers used in first and second round reactions for all tests. We used published primers (references in text) upon which an M13 tail was added (shown in lower case). MIDs 1–96²⁵ were used in both the forward and reverse primers.

Test	Primer	Sequence 5′ – 3′
Test 1	Thr-L-t	gttttcccagtcacgacGAATTCCCCGGTCTTGTAAACC
Test 1	ddl5-t	aacagctatgaccatgCATTAATGCACGACGTACATAGG
Test 2	PpLAa2U270 -t	gttttcccagtcacgacGCTTCTCATCCTAGTTCCCTT
Test 2	Ppa2L542-t	aacagctatgaccatgGCCTAGGAGTGCAGCAGA
Test 3	Be3-t	gttttcccagtcacgacGGGTCTCACACCYKCCAG
Test 3	Be4-t	aacagctatgaccatgGMGCWGCAGSGTCTCYTT
Second round	forward	CGTATCGCCTCCCTCGCGCCATCAG[MID]gttttcccagtcacgac
Second round	reverse	CTATGCGCCTTGCCAGCCCGCTCAG[MID]aacagctatgaccatg

Table 2. Primers used in first and second round reactions for all tests. We used published primers (references in text) upon which an M13 tail was added (shown in lower case). MIDs 1–9625 were used in both the forward and reverse primers.