Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used in study.
| Targeted mRNA | Primer | Length |
| Rat Pdx-1 | F: gaggacccgtacagcctaca | 201 bp |
| R: cgttgtcccgctactacgtt | ||
| Rat Insulin | F: ccgtcgtgaagtggagga | 154 bp |
| R: cagttggtagagggagcagat | ||
| Rat Cytokeratin 19 | F: atccccaaagacacgagatg | 200 bp |
| R: gtgagctacaaccgcagctt | ||
| Rat β-actin | F: taaagagaagctgtgctatgttgc | 354 bp |
| R: atgatcttgatcttcatggtgcta |
