Skip to main content
. 2014 Dec 17;5(2):235–239. doi: 10.1534/g3.114.015164

Figure 2.

Figure 2

CD94 expression of D2 variants and B6. (A) CD94 expression was evaluated in peripheral blood by flow cytometry (Accuri C6, BD). Antibody staining was performed using NKp46-PerCP (eBioscience) as natural killer cell−specific marker and CD94-PE (BioLegend), respectively. Analysis was done with the software FlowJo. (B) Expression of CD94 determined by flow cytometry is significantly reduced in D2Rj mice compared with B6 (one representative experiment is shown, n = 4, females, 10-12 wk old; P < 0.05, Student’s t-test). (C) Amplification of genomic regions by polymerase chain reaction (PCR). DNA from D2J (lane 1), D2Rj (lane 2), D2Rj.2 (lane 3), B6 (lane 4), BXD9 (lane 5), BXD13 (lane 6), BXD31 (lane 7), and BXD98 (lane 8) was analyzed by PCR, using primers that hybridize to the presumed deleted region in D2J (fw-5′ tggccaggcaaagtgatacatacct; rev-5′acaatgcagtgctctggcctga).