Figure - PMC

Skip to main content

An official website of the United States government

Here's how you know

Here's how you know

Official websites use .gov
A .gov website belongs to an official government organization in the United States.

Secure .gov websites use HTTPS
A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.

View full-text article in PMC

. 2014 Dec 17;5(2):235–239. doi: 10.1534/g3.114.015164

Search in PMC
Search in PubMed
View in NLM Catalog
Add to search

Copyright © 2015 Shin et al.

This is an open-access article distributed under the terms of the Creative Commons Attribution Unported License (http://creativecommons.org/licenses/by/3.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PMC Copyright notice

CD94 expression of D2 variants and B6. (A) CD94 expression was evaluated in peripheral blood by flow cytometry (Accuri C6, BD). Antibody staining was performed using NKp46-PerCP (eBioscience) as natural killer cell−specific marker and CD94-PE (BioLegend), respectively. Analysis was done with the software FlowJo. (B) Expression of CD94 determined by flow cytometry is significantly reduced in D2Rj mice compared with B6 (one representative experiment is shown, n = 4, females, 10-12 wk old; P < 0.05, Student’s t-test). (C) Amplification of genomic regions by polymerase chain reaction (PCR). DNA from D2J (lane 1), D2Rj (lane 2), D2Rj.2 (lane 3), B6 (lane 4), BXD9 (lane 5), BXD13 (lane 6), BXD31 (lane 7), and BXD98 (lane 8) was analyzed by PCR, using primers that hybridize to the presumed deleted region in D2J (fw-5′ tggccaggcaaagtgatacatacct; rev-5′acaatgcagtgctctggcctga).