Table 1.
Properties of primers used in the real-time RT-PCR reaction. Each gene number, sequence, size, and amount of primer used has been specified separately
| Property | CEA | LunX | 18s rRNA |
|---|---|---|---|
| NCBI accession number | M29540 | NM_016583.3 | X03205 |
| Forward primer | accctggatgtcctctatgg | CCACCGTCTCTATGTCACCA | gtaacccgttgaaccccatt |
| primer length | 20 | 20 | 20 |
| amount of use | 15 picomol | 10 picomol | 10 picomol |
| Reverse primer | caggcataggtcccgttatta | GCCAAGTCCATCAAGCAGA | ccatccaatcggtagtagcg |
| primer length | 21 | 19 | 20 |
| amount of use | 10 picomol | 10 picomol | 10 picomol |
| Amplicon length | 174 | 211 | 152 |
| Optimized annealing temperature | 61.2°C | 61.4°C | 53.5℃ |
CEA, carcinoembryonic antigen