| gRNA oligos | Forward primer 5′ - 3′ | Reverse primer 5′ - 3′ |
|---|---|---|
| Jmjd3 gRNA #1 | cacctgtggatgttacccgcatga | aaactcatgcgggtaacatccaca |
| Jmjd3 gRNA #2 | caccgtccctggcagccgaacgcc | aaacggcgttcggctgccagggac |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.