Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Oligonucleotides used for genotyping mice
| Amplified sequence | Forward primer | Reverse primer | Product size (bp) |
|---|---|---|---|
| Entpd2 WT | gttagggggtgtctgtctgg | aaatgctgcctggaaatgg | 309 |
| neomycin cassette | ccgtaaagcacgaggaagc | ctggacgaagagcatcagg | 263 |
| Entpd2 KO | tcctgtcatctcaccttgctcctgc | gtttaagtgttgctctctgaccaactggc | 3904 |
| P2ry1 WT | acagtactgtcgcctcaactgcagcagttt | ccgaagatccagtcagtcttgttgaagtag | 290 |
| P2ry1 KO | gccttctatcgccttcttgacgagttcttc | ccgaagatccagtcagtcttgttgaagtag | 660 |
